From brian at gweep.ca Sat Jan 3 22:39:33 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:00 2005 Subject: PRO/PL> Announcements 2004 (1): Plant pest updates Message-ID: <37smiww9uy.fsf@lios.aq2.gweep.ca> ANNOUNCEMENTS 2004 (1): PLANT PEST UPDATES ****************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 30 Dec 2003 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO) Secretariat, 2003-09 EC [edited] EU Plant Health Directive 2003/29 EC: Amendments --------------------------------------- The Agriculture Council adopted on 2002-11-28 amendments to Directive 2000/29/EC, which deals with protective measures against the introduction and spread of organisms harmful to plants or plant products in the European Union. The overall aim of the EU plant health legislation is to ensure protection against pests that affect plants or plant products. The benefits of the amended Directive include: - strengthening of import clearance procedures for plants and plant products - improved conditions for cooperation between customs authorities and official phytosanitary bodies in Member States - better information for importers - establishment of a harmonized system of fees - adjustments of the EU Plant Health regime to the conditions of the internal market, responding to risks resulting from increased trade. The amended Directive came into force on 30 Dec 2002, the day of its publication in the Official Journal, and requires Member States to adopt and publish the provisions necessary to comply with it before 1 Jan 2005. The Commission will now focus on preparing various implementing measures such as cooperation between the official phytosanitary bodies in the Member States and the Customs authorities, model forms of documents to be used in that co-operation, and the means of transmission of these documents. Such measures must be taken to maintain the identity of the consignments and to safeguard against spread of pests during transport until completion of the required phytosanitary and customs formalities. Source: Council Directive 2002/89/EC of 28 Nov 2002 amending Directive 2000/29/EC on protective measures against the introduction into the Community of organisms harmful to plants or plant products and against their spread within the Community Official Journal L 355 , 30/12/2002 P. 0045 - 0060 EU Press Release of 2002-11-28. EU Plant Health Regime improved to reduce risk of importing harmful organisms. ****** [2] Date: 30 Dec 2003 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO), No. 12 [edited] EPPO Index for 2003 ------------------- The index covers all Reporting Service articles published in 2003. This index is available as an Excel file from the EPPO Web site and the EPPO Electronic Documentation Service. ------------------------------ ProMED-mail .........................dh/pg/jw *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jan 5 16:41:31 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:00 2005 Subject: PRO/PL> Grapevine yellows phytoplasmas, new data, EPPO Message-ID: <37u13armj9.fsf@lios.aq2.gweep.ca> GRAPEVINE YELLOWS PHYTOPLASMAS, NEW DATA, EPPO ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 3 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 10 [edited] 2003/152 New data on grapevine flavescence doree and other grapevine yellows Numerous papers were presented on grapevine yellows during the 14th ICVG Conference (Locorotondo, IT, 2003-09-12/17). The EPPO Secretariat has extracted the following new data concerning these diseases. The following [information], adapted from Boudon-Padieu (2003), summarizes the current knowledge about grapevine diseases and their associated phytoplasmas observed in different parts of the world. Disease, Phytoplasma name, Ribosomal group/subgroup), Known insect vector, Vector hosts, Distribution Flavescence doree (FD), EY or 16SrV (-C, -D), _Scaphoideus titanus_, _Vitis_, France, Italy, Spain Palatinate grapevine yellows (PGY), EY or 16SrV, _Oncopsis alni_, _Alnus glutinosa_, Germany Bois noir, legno nero and Vergilbungskrankheit, Stolbur, Stolbur or 16SrXII-A, _Hyalesthes obsoletus_, _Convolvulus arvensis_, _Urtica dioca_, _Ranunculus_, _Solanum_, Lavandula__, -, -, Europe, Israel, Lebanon Australian grapevine yellows, _Candidatus Phytoplasma australiense_, Stolbur or 16SrXII-B, -, -, Australia Australian grapevine yellows, Tomato big bud, FBP or 16SrII, -, -, Australia Buckland valley grapevine yellows, BVGY, AY or 16SrI-related, -, -, Australia Grapevine yellows, Aster yellows AY or 16SrI-A, -, -, Italy North American grapevine yellows, Western X, W-X or 16SrIII-I, -, -, New York, Virginia ------------------------------ ProMED-mail [This is a useful collection of new data concerning grapevine phytoplasmas, which are resident in many countries. Phytoplasmas continue to be recognized as significant pathogens of grapevine and other crops. A good reference on this topic is the following: - Mod.DH] [see also: 2003 ---- Phytoplasmas, fruit trees, grapevine - Albania 20030819.2083 Grapevine yellows - France 20030315.0641 Grapevine flavescence doree phytoplasma - Italy & Serbia 20030717.1754 Elm yellows phytoplasma, grapevine - Serbia 20030523.1261 2002 ---- Bois noir phytoplasma, grapevine - Switzerland 20020712.4739 Bois Noir phytoplasma, grapevine - Lebanon 20020711.4723 2001 ---- Phytoplasma sp., fruit - Australia, New Zealand 20010320.0561 1999 ---- EPPO alert list, part 3/5: August 1999 19991028.1951 Grapevine bois noir epidemiology - France 19990718.1212 Australian grapevine yellows - Australia, New Zealand 19990622.1064 Grapevine yellows - Australia (Victoria): Correction 19990618.1035 Grapevine B virus - Australia (Victoria) 19990618.1034 Grapevine yellows - Australia (Victoria) 19990617.1030] .............................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jan 5 16:41:46 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:00 2005 Subject: PRO/PL> Grapevine flavescence doree, status - France Message-ID: <37ptdyrmiu.fsf@lios.aq2.gweep.ca> GRAPEVINE FLAVESCENCE DOREE, STATUS - FRANCE ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 4 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 10 [edited] 2003/153 Situation of grapevine flavescence doree in France In France, grapevine flavescence doree disease (EPPO A2 list) remained stable in 2003. However, despite compulsory control measures, a few new outbreaks were discovered at Moissac (Tarn-et-Garonne), in Vaucluse, Gironde, and Charentes. Surveys for the insect vector _Scaphoideus titanus_ (St) showed that it is still absent from the vineyards of Alsace, Champagne, Vendee, and from cv. Muscadet in the Loire Valley (Herlemont, 2003). A new decree, published in 2003 to clarify and strengthen compulsory control measures against grapevine flavescence doree and its vector, applies to all _Vitis_ plants (cultivated or wild). When an infected _Vitis_ plant is found, a quarantine area (called 'perimetre de lutte') is delimited around it for a minimum of 2 years. The delimited zone includes at least one commune. All infected plants must be destroyed, and compulsory control against the vector is required in that zone. The decree also contains a set of special requirements for nurseries. Growth of mother plants is prohibited in the vicinity of a delimited zone. Hot water treatment is also included for planting material. Possibilities for biological control of St are being investigated. This insect is thought to have originated from the Great Lakes region in USA and Canada, where it occurs in low abundance. Earlier observations made in New York State had revealed the existence of parasitoids (Hymenoptera: Dryinidae). Further surveys in 2001/2002 by French scientists (Malausa et al., 2003) were made to look for possible biological control agents of St in its area of origin. In the Finger Lakes region (New York State), insects were collected in vineyards and wild _Vitis_ plants or 'trapped' on reared eggs of St exposed in the field. Several parasitoid species were found, including _Lonchodryinus flavus_ and _Gonatopus peculiaris_ (both _Hymenoptera_, _Dryinidae_) and several species of oophagous parasitoids (_Diptera_, _Pipunculidae_). Further studies are needed to rear these species in the laboratory and to evaluate their biological characteristics, as well as their efficacy and safety, prior to any release in vineyards. Source: Decret du 9 juillet 2003 relatif a la lutte contre la flavescence doree de la vigne et contre son agent vecteur. Journal Officiel no. 167 du 22 juillet 2003, p 12362. Herlemont, B. (2003) Bilan phytosanitaire de la vigne en 2003. Climatologie exceptionnelle et reglementation en mouvement. Phytoma - La Defense des Vegetaux, no. 565, 14-19. Malausa, J.C. ; Nusillard, B. ; Giuge, L. (2003) Lutte biologique contre la cicadelle vectrice de la flavescence doree. Phytoma - La Defense des Vegetaux, no. 565, 24-27. de la Roque, B. (2003) Flavescence doree: reglementation depoussieree. Phytoma - La Defense des Vegetaux, no. 565, 22-23. ------------------------------ ProMED-mail [Management of flavescence in orchards depends on the use of insecticides to reduce populations of the vector (St). A regimen of tissue culture under defined heat conditions can rid vines of the phytoplasma. A search for parasitoids that could be used for biological control of St is worth investigating. Another useful reference: - Mod.DH] [see also: 2003 ---- Phytoplasmas, fruit trees, grapevine - Albania 20030819.2083 Grapevine flavescence doree phytoplasma - Italy & Serbia 20030717.1754 Elm yellows phytoplasma, grapevine - Serbia 20030523.1261 Grapevine yellows - France 20030315.0641 2002 ---- Bois noir phytoplasma, grapevine - Switzerland 20020712.4739 European stone fruit yellows, phytoplasma - Austria 20020424.4024 Quarantine plant pathogens, food crops - Spain 20020107.3186 2000 ---- Plant quarantine pests - Italy: 1999 20000611.0948 1999 ---- Plant pests - Russia 19991202.2114 1997 ---- Grapevine flavescence doree phytoplasma - Spain 19970725.1561] ......................................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jan 5 16:41:55 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Criniviruses, tomato - Spain: current status Message-ID: <37llomrmik.fsf@lios.aq2.gweep.ca> CRINIVIRUSES, TOMATO - SPAIN: CURRENT STATUS ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 2 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No.10 [edited] 2003/150 Details on the situation of Tomato chlorosis and Tomato infectious chlorosis criniviruses In 1997, unusual symptoms were observed on tomato crops in M?laga and Almer?a in Spain. Symptoms were characterized by interveinal yellowing of leaves and purple discoloration in some cases. The disease was associated with high populations of whiteflies. In 2000, Tomato chlorosis crinivirus (ToCV - EPPO Alert List) was identified as the causal agent. This virus was also found in 2000 in Tenerife and Gran Canaria (Islas Canarias). In 2001, another virus causing similar symptoms, Tomato infectious chlorosis crinivirus (TICV - EPPO Alert List), was identified on tomato crops in Benicarlo (Castellon). From April 2001 to December 2002, a total of 196 samples of symptomatic tomato plants, collected from the main tomato-growing regions of Spain, were tested by RT-PCR for the presence of ToCV and TICV. ToCV was detected in 95 samples from: Alicante, Almeria, Castellon, Gran Canaria, Mallorca (Baleares), Murcia, Sevilla, Gran Canaria and Tenerife (Islas Canarias). TICV was detected in 16 tomato samples from Alicante and Castellon. Both viruses were found in 3 samples from Alicante. The situation of Tomato chlorosis crinivirus in Spain can be described as follows: Present, found in Andalucia (Almeria, Malaga, Sevilla), Comunidad Valenciana (Alicante, Castellon), Murcia, Islas Baleares (Mallorca), Islas Canarias (Tenerife, Gran Canaria). The situation of Tomato infectious chlorosis crinivirus in Spain can be described as follows: Present, found in Comunidad Valenciana (Alicante, Castellon). Source: Font, M.I.; Vaira, A.M.; Accotto, G.P.; Lacasa, A.; Serra, J.; Gomila, J.; Juarez, M.; Espino, A.I.; Jorda, M.C. (2003) Amarilleos en los cultivos de tomate asociados a Tomato chlorosis virus (ToCV) y Tomato infectious chlorosis virus (TICV) en Espana. Boletin de Sanidad Vegetal, Plagas, 29(1), 110-121. ------------------------------ ProMED-mail [Criniviruses are filamentous viruses containing 2 separate genomic segments (650-850 and 700-900 nm), both of which are required for infectivity. Tomato (field and glasshouse) is the main host, but other crops such as potato (_Solanum tuberosum_) and lettuce (_Lactuca sativa_) are susceptible. 2 weed species (Jimson weed, _Datura stramonium_ and Black nightshade, _Solanum nigrum_) are also hosts that may contribute to maintaining these viruses in the wild. TICV is transmitted only by _T. vaporariorum_, but ToCV is transmitted by the greenhouse whitefly (_Trialeurodes vaporariorum_), the banded-wing whitefly (_T. abutilonea_), and by _Bemisia tabaci_ (biotype A) and _B. argentifolii_ (biotype B). Once either virus is established in an agricultural environment containing susceptible hosts, it is very difficult to prevent infection. Disease management requires use of virus-free transplants, avoidance of susceptible hosts (especially weeds), roguing (physical removal) of infected plants, and control of insect vectors by insecticides. - Mod.DH] [see also: 2003 ---- Tomato infectious chlorosis, tomato - Indonesia 20030709.1676 Tomato and cucurbit viruses - France 20030503.1107 2002 ---- Tomato criniviruses, detection - Greece 20021130.5939 Tomato infectious chlorosis virus, tomato - Spain 20020706.4678 2001 ---- Beet pseudoyellows virus, cucumber - New Zealand 20011116.2823 Cucurbit yellow stunting dis. crinivirus - Portugal 20010529.1040 Whitefly-transmitted criniviruses, virion lengths 20010524.1005 Tomato chlorosis crinivirus - Puerto Rico 20010515.0942 Tomato chlorosis crinivirus disease - Puerto Rico 20010324.0588] .......................dh/pg/mpp/dh/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Tue Jan 6 14:59:35 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Potato cyst nematodes, survey - UK (England, Wales) Message-ID: <37smispwl4.fsf@lios.aq2.gweep.ca> POTATO CYST NEMATODES, SURVEY - UK (ENGLAND, WALES) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 5 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 10 [edited] 2003/156 Survey on potato cyst nematodes in England and Wales A survey was carried out in England and Wales (United Kingdom) for the presence of potato cyst nematodes (_Globodera rostochiensis_ [Gr], _G. pallida_ [Gp] - both on the EPPO A2 list). The aim was to estimate the proportion of potato fields infested with potato cyst nematodes [PCN] and to determine the relative abundance of the 2 species. From 1997 to 1998, soil samples were collected from fields where potato had been grown the previous year. 284 potato growers agreed to participate to this study. PCN were found in 64 percent of tested samples (a similar study done in 1996 had given 42 percent). Gp is the predominant species found in England and Wales: 8 percent of the populations were Gr, 67 percent were Gp and 25 percent were mixed populations. In most cases, population densities were low (62 percent of the infestations had a density of less than 10 eggs/g of soil). Gp was mainly found in the eastern counties of Lincolnshire, Yorkshire, and Cambridgeshire, where many potatoes are grown. Gr was present in eastern and western counties, almost equally, frequently in the same locations as Gp. Significant relationships were observed between species of PCN found and the use of resistant and non-resistant potato cultivars. It is concluded that priority should be given to preventing further spread of these nematodes to potato-growing land and that integrated management strategies (use of resistant cultivars, nematicides, longer crop rotations, and possibly trap cropping) should be recommended to growers. Source: Minnis, S.T.; Haydock, P.P.J.; Ibrahim, S.K.; Grove, I.G., Evans, K.; Russell, M.D. (2002) Potato cyst nematodes in England and Wales - occurrence and distribution. Annals of applied Biology, 140(2), 187-195. ------------------------------ ProMED-mail [Potato cyst nematodes attacks potato roots, causing very significant yield reduction (up to 70 percent) over time. The cysts can remain viable for up to 30 years in some instances. They are worldwide in distribution and are considered one of the most difficult plant diseases (pests) to manage. - Mod.DH] [see also: 2003 ---- Plant pests, new data, EPPO (04) 20030915.2336 Plant pests, new data, EPPO 20030312.0608 2002 ---- Potato cyst nematode, potato - Czech Republic 20021228.6141 Potato cyst nematode, potato - Hungary 20021012.5538 Quarantinable plant pests - Latvia 20020726.4867 Potato nematodes, potato - Czech Republic 20020106.3168] ........................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Tue Jan 6 18:02:34 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> EU Plant Health Directive 2000/29 EC : Amendments Message-ID: <37ekuco9jp.fsf@lios.aq2.gweep.ca> EROPEAN UNION PLANT HEALTH DIRECTIVE 2000/29 EC : AMENDMENTS ************************************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 5 Jan 2004 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO) [edited] Amendments to EU Plant Health Directive 2000/29 EC The Agriculture Council adopted on 2002-11-28 amendments to Directive 2000/29/EC, which deals with protective measures against the introduction and spread of organisms harmful to plants or plant products in the European Union. The overall aim of the EU plant health legislation is to ensure protection against pests that affect plants or plant products. The benefits of the amended Directive include: - strengthening of import clearance procedures for plants and plant products - improved conditions for cooperation between customs authorities and official phytosanitary bodies in Member States - better information for importers - establishment of a harmonized system of fees - adjustments of the EU Plant Health regime to the conditions of the internal market, responding to risks resulting from increased trade. The amended Directive came into force on 2002-12-30, the day of its publication in the Official Journal, and requires Member States to adopt and publish the provisions necessary to comply with it before 1 Jan 2005. The Commission will now focus on preparing various implementing measures such as cooperation between the official phytosanitary bodies in the Member States and the Customs authorities, model forms of documents to be used in that cooperation, and the means of transmission of these documents. Such measures must be taken to maintain the identity of the consignments and to safeguard against spread of pests during transport until completion of the required phytosanitary and customs formalities. Source: Council Directive 2002/89/EC of 28 November 2002 amending Directive 2000/29/EC on protective measures against the introduction into the Community of organisms harmful to plants or plant products and against their spread within the Community Official Journal L 355 , 30/12/2002 P. 0045 -0060 EU Press Release of 2002-11-28. EU Plant Health Regime improved to reduce risk of importing harmful organisms. ------------------------------ ProMED-mail ....................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Jan 7 11:41:42 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Quarantine pests, new data - EPPO Message-ID: <37ptdvlhy4.fsf@lios.aq2.gweep.ca> QUARANTINE PESTS, NEW DATA - EPPO ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 5 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 10 [edited] 2003/141 New data on quarantine pests and pests of the EPPO Alert List By browsing through the literature, the EPPO Secretariat has extracted the following new data concerning quarantine pests and pests included on the EPPO Alert List. The situation of the pest concerned is indicated in bold, using the terms of ISPM no. 8. New geographical records ------------------------ _Curtobacterium flaccumfaciens_ pv. _flaccumfaciens_ [Cff] (EPPO A2 list) is reported for the first time from Alberta and Saskatchewan, Canada (Huang et al., 2003). Results of a survey in 2001 revealed that the disease was widespread in the dry bean production regions of southern Alberta, and also in Saskatchewan. First reported in a single instance in 1954 but no longer reported and considered absent from Canada. Status in Canada: Present, found in 2001 in Alberta and Saskatchewan. Detailed records ----------- During a survey done in 2002 in Quebec and Ontario (Canada), symptoms of _Pantoea stewartii_ subsp. _stewartii_ (EPPO A2 list) were observed at 42 locations in 10 counties of Ontario. The disease was not found in Quebec (Zhu et al., 2003). _Xanthomonas axonopodis_ pv. _phaseoli_ (EPPO A2 list) occurs in bean crops in Manitoba, Canada (Yager & Conner, 2003). Sources: Huang, H.C.; Hsieh, T.F.; Erickson, R.S. (2003) Distribution of new seed-borne diseases of dry bean in Alberta and Saskatchewan in 2001. Canadian Plant Disease Survey. 2003. Disease highlights. Canadian Phytopathological Society. Agriculture and Agri-Food Canada, 90-91. Yager, L.; Conner, R.L. (2003) Diseases of field bean in Manitoba in 2002. Canadian Plant Disease Survey. 2003. Disease highlights. Canadian Phytopathological Society. Agriculture and Agri-Food Canada, 92-93. Zhu, X.; Reid, L.M.; Woldemariam, T.; Tenuta, A.; Jay, S.; Lachance, P. (2003) Survey of corn diseases and pests in Ontario and Quebec in 2002. Canadian Plant Disease Survey. 2003. Disease highlights. Canadian Phytopathological Society. Agriculture and Agri-Food Canada, 81-84. ------------------------------ ProMED-mail [Cff causes bacterial tan spot in bean (_Phaseolus vulgaris_) and soybean (_Glycine max_). It is internally seedborne in legumes. Pathogenesis is facilitated by higher temperatures (25-30 deg C). Disease incidence can be reduced by planting pathogen-free seed or by using seed of less susceptible cultivars. Stewart's wilt (a.k.a. bacterial leaf blight of maize), caused by _Pantoea stewartii_ subsp. _stewartii_, is transmitted primarily by corn flea beetles (_Chaetocnema pulicaria_) and by seed. Disease management includes using resistant cultivars and insecticides to reduce flea beetle populations. Comparative tests (1995-1998) have evaluated several semi-selective media for use in the detection of_ Xanthomonas axonopodis_ pv. _phaseoli_ [Xap] in bean seed. 2 media XCP1 and MT have been chosen for their ease of use and selectivity for Xap. Both media rely on the ability of Xap to hydrolyze starch. The fact that a PCR-based system for detection of Cff was recently developed in Italy suggests that development of a similar system for Xap might be worth investigating. - Mod.DH] [see also: 2003 ---- Regulated plant pests, detection, July 2003: EPPO 20030913.2316 Plant pests, new data, EPPO (03) 20030728.1853 Regulated plant pests, detection, March 2003: EPPO 20030506.1128 Plant pests, new data, EPPO 20030312.0608 2000 ---- Plant pathogens, intercepts, EPPO 20000204.0170 1999 ---- Plant pests - Russia 19991202.2114] .......................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Fri Jan 9 21:00:25 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Bacterial wilt, banana - Uganda (Mukono, Kayunga) Message-ID: <37isjkfo6f.fsf@lios.aq2.gweep.ca> BACTERIAL WILT, BANANA - UGANDA (MUKONO, KAYUNGA) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 8 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 11 [edited] 2003/171 _Xanthomonas campestris_ pv. _musacearum_ causes a new and serious disease of banana in Eastern Africa In Uganda, a new and serious disease of banana has been observed in the major banana-growing areas (districts of Mukono and Kayunga) since 2001. The 1st symptoms included discoloration of flowers and withering of flower bracts, premature flowering of young plants, leaf yellowing, and wilting. Affected plants die within a month. Diseased tissue samples were sent to CABI Bioscience in United Kingdom, and the presence of _Xanthomonas campestris_ pv. _musacearum_ [Xcm] was detected. A similar bacterium had previously been reported to cause wilt of _Ensete ventricosum_ (enset or wild banana) in Ethiopia. In Uganda, the disease is spreading very rapidly, and the destruction of the affected crops by burning is -- so far -- the only control method available. Further studies are underway to confirm the identification of the bacterium and to characterize isolates from Ethiopia and Uganda. This emerging disease is considered to be a very serious threat to banana production in Eastern Africa and potentially worldwide. Sources: Korobko, A.P. (1997) Bacterial wilt of pseudobanana (Ensete ventricosum). Mikrobiologichnii Zhurnal, 59(2), 44-53 (abst.). Yirgou, D.; Bradbury, J.F. (1974) A note on wilt of banana caused by the enset wilt organism Xanthomonas musacearum. East African Agricultural and Forestry Journal, 40(1), 111-114. INTERNET CABI Bioscience web site - News release of 21st January 2003. New disease threatens Eastern African banana production ProMED postings Banana wilt, banana - Uganda, 2002-01-04 Matoke disorder, banana - Uganda, 2002-01-18 Banana wilt - Uganda (Kayunga), 2002-07-17 Banana wilt, banana - Uganda, 2003-03-03 Additional references: ------------------------------ ProMED-mail [The banana bacterial wilt pathogen (Xcm), 1st reported in Ethiopia, caused only minor damage, because banana production was practiced on a small-scale basis. Its spread to Uganda and other areas of eastern Africa is a direct threat to banana, which is a staple food crop, and over 90 percent of production is from smallholders for home consumption or local trade. High-density production of banana in Uganda is intensive and thus disease spread is rapid and difficult to control. The mode of transmission suggests that Xcm may spread by aerosol or by insects. Although the only eradicative procedure is the use of fire, disease management in the long term must depend upon selection or development of resistant cultivars. It would be interesting to know whether there are differences in the genotypes of Xcm collected from different areas in Africa. - Mod.DH] [see also: 2003 ---- Bacterial wilt, banana - Uganda 20030319.0680 2002 ---- Banana wilt - Uganda (Kayunga) 20020718.4791 Banana wilt, banana - Uganda 20020105.3162] ......................dh/pg *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Fri Jan 9 21:00:14 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Watermelon chlorotic stunt virus - Israel Message-ID: <37n08wfo6p.fsf@lios.aq2.gweep.ca> WATERMELON CHLOROTIC STUNT VIRUS - ISRAEL ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 7 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 11 [edited] 2003/164 First report of Watermelon chlorotic stunt begomovirus in Israel The NPPO of Israel (PPIS) informed the EPPO Secretariat of the discovery of the whitefly-transmitted Watermelon chlorotic stunt begomovirus (WmCSV - EPPO Alert List) in Israel. WmCSV symptoms were first observed in Autumn 2002 affecting one plot of cultivated watermelon (_Citrullus lanatus_) in southern Israel. Following positive identification of the virus, previously recorded from only Iran, Sudan, Yemen, and possibly Saudi Arabia and Greece, the affected 2 hectares were ordered destroyed by PPIS. In 2003 the disease was reported again from additional areas in the country on watermelon and melon (_Cucumis melo_). The status of this pest in Israel can be described as: Present, distribution under surveillance. Source: NPPO of Israel, 2003-12. ------------------------------ ProMED-mail [WmCSV, vectored by _Bemisia tabaci_, is likely established in the affected areas of Israel. Its natural host range includes several other species, including _Citrullus lanatus var. citrioides [Citron], _C. echirrhosus_, and _C. colocynthis_ [Bitter apple], which may function as alternate hosts as sources of inoculum. - Mod.DH] [see also: 2003 ---- Watermelon chlorotic stunt, cucurbits - Iran 20030129.0257 2000 ---- Watermelon chlorotic stunt virus: EPPO report 20001215.2188] .......................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Jan 14 14:00:22 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Ralstonia solanacearum, survey - United Kingdom Message-ID: <37brp66yah.fsf@lios.aq2.gweep.ca> RALSTONIA SOLANACEARUM, SURVEY - UNITED KINGDOM ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 9 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 11 [edited] 2003/166 Survey on _Ralstonia solanacearum_ in United Kingdom: 2003 results In United Kingdom [U.K.], there have been 5 confirmed outbreaks of _Ralstonia solanacearum_ [Rs] (EPPO A2 list) in potato crops: 2 in the Thames Valley (in 1992 and 1995), 2 in Northamptonshire (in 1999), and 1 in Kent (in 2000). The bacterium has also caused 2 outbreaks in tomato crops grown at one locality in Bedfordshire (in 1997 and 1998). All these cases were apparently caused by irrigating crops with water from contaminated rivers, where the bacterium persists by infecting _Solanum dulcamara_ (bitter nightshade) with roots in the water. Monitoring programmes and eradication measures are being applied in U.K. Since the last outbreak in 2000, Rs has not been detected on crops but only in watercourses. Results of the 2003 action and survey are presented in detail on the web site of DEFRA. Numerous herbicide spot treatments were applied against _S. dulcamara_ along watercourses (4000 in June/July 2003, and 2000 treatments in September 2003). Rs was absent in 41 of the 65 sites sampled (63 percent). The bacterium was found in water samples from 12 water courses (essentially located in the south and south-east of England). The situation of Rs in United Kingdom can be described as follows: Present, the bacterium has been eradicated from solanaceous crops but can still be detected in a few watercourses. Source: Web site of Department for Environment, Food and Rural Affairs (DEFRA), United Kingdom: Potato brown rot: 2003 monitoring programme: Final results. ------------------------------ ProMED-mail [In February 2003, Rs race 3, biovar 2, not known to occur in the USA, was detected and confirmed in geraniums imported from Kenya and eradicated. Subsequently it occurred again in late December 2003 in geranium imported from Guatemala. The pathogen causes a wilt disease in several important agricultural crops such as potato, tomato, pepper, and eggplant. Some control actions have already taken place, and importations into the United States have ceased. Primary symptoms of Rs race 3, biovar 2 infection in geranium are wilting of leaves and/or abnormal yellowing of lower leaves. Rs can be transmitted through soil, contaminated irrigation water, equipment, or personnel. Rs does not readily spread from plant to plant via splashing water, casual contact, or aerially. Spread can be controlled in greenhouses by application of sound sanitation practices. Rs is thought to have originated in the temperate highland regions of Peru but has subsequently spread to Europe, Asia, South and Central America, and Australia. It has been classified into a number of races and biovars. Most races of the bacterium, and their associated diseases, appear to be limited to tropical, sub-tropical and warm temperate climates, and thus pose no long-term threat to agriculture in cool temperate climates. However, Rs race 3, biovar 2A, which has a very wide host range, is now considered to be a quarantine pest in Europe, Canada, and the United States. Additional references: - Mod.DH] [see also: 2003 ---- Quarantine pests, surveys - Latvia: 2000 20031219.3093 2002 ---- Quarantinable plant pests - Hungary 20021115.5812 Quarantine plant pathogens, food crops - Spain 20020107.3186 2001 ---- Ralstonia sp., eradicated - France 20010507.0878 2000 ---- Ralstonia solanacearum, potatoes - Hungary 20001010.1733 Potato wilt, bacterial (brown rot) - Belgium 20000520.0791 1999 ---- Ralstonia solanacearum, potatoes - Syria? (02) 19991210.2143 Ralstonia potato wilt, prevention - France 19990820.1441 Ralstonia solanacearum, potatoes - Syria? 19990703.1117 Potato & tomato diseases - Europe 19990524.0863] ........................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Jan 14 14:02:47 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: APS Press Release: California Pistachio Industry Message-ID: <377jzu6y6g.fsf@lios.aq2.gweep.ca> PRESS RELEASE For immediate release Contact: Amy Steigman American Phytopathological Society E-mail: mailto:asteigman@scisoc.org Phone: +1.651.454.7250 / Web: http://www.apsnet.org/ California Pistachio Industry Threatened by Potentially Devastating Disease St. Paul, Minn. (January 9, 2004) - The California pistachio industry produced approximately 300 million pounds of pistachios in 2002 and continues to grow each year at an impressive rate. However, plant pathologists with The American Phytopathological Society (APS) say a serious and devastating disease could put a definite halt to this relatively young industry. According to Themis J. Michailides, plant pathologist at the University of California, Davis, this disease, panicle and shoot blight of pistachio, was first discovered in 1984 in a commercial orchard in the northern Sacramento Valley and has since become a disease of major importance for pistachios grown in California. "Yield losses from 40 to 100 percent were not uncommon in the orchards where the disease was discovered," said Michailides. "The destruction caused by this disease makes panicle and shoot blight the most serious threat to pistachio trees grown in California," he said. Panicle and shoot blight is caused by Botryosphaeria dothidea, a fungus that causes diseases that are aggressive and very difficult to control. According to Michailides, the pistachio industry in California is based on a cultivar that is very susceptible to this particular fungus. "Because of the California pistachio's susceptibility to this fungus, panicle and shoot blight has the potential to reach epidemic levels in pistachio orchards in only a few years," he said. To prevent such epidemics from occurring, and since some resistance to the disease exists in the present Pistacia germplasm, breeders need to work closely with plant pathologists to develop disease resistant varieties of the pistachio tree. In addition, Michailides also recommends growers remain proactive in their efforts to keep their orchards free from infection of the pathogen by conducting regular surveys, sanitation by pruning of possible infections, controlling insects, and following fungicide programs that were shown to control panicle and shoot blight. More on this subject is available in this month's APS feature article on the APS website at http://www.apsnet.org/ . The American Phytopathological Society (APS) is a non-profit, professional scientific organization dedicated to the study and management of plant disease with 5,000 members worldwide. From brian at gweep.ca Wed Jan 14 17:48:47 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Quarantine pests - Italy (Valle d'Aosta) Message-ID: <37ad4q3ukw.fsf@lios.aq2.gweep.ca> QUARANTINE PESTS - ITALY (VALLE D'AOSTA) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 13 Jan 2004 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO) Reporting Service 2003, No. 11 [edited] 2003/165 Details on several quarantine pests in Valle d'Aosta region (Italy) ---------------------------------------------------------------------------- The EPPO Secretariat has extracted the following data from the 2002 Annual Report of the phytosanitary service of Valle d'Aosta region (IT). Apple proliferation phytoplasma [APP] (EPPO A2 list): the disease is widespread in Valle d'Aosta, especially in old orchards, where disease incidence can reach 100 per cent. A sanitation programme is being implemented. Trees are inspected for the presence of typical symptoms or tested when no symptoms are found. Infected trees are destroyed, and when more than 25 per cent infection is observed, the whole orchard is destroyed. _Clavibacter michiganensis_ subsp. _sepedonicus_ [Cms] and _Ralstonia solanacearum_ [Rs] (both on EPPO A2 list): numerous potato fields were inspected; neither of these bacteria was detected. _Erwinia amylovora_ [Ea] (EPPO A2 list): a monitoring programme has been set up since 1992. In 2002, 50 permanent sites were inspected twice. Ea was not found. _Globodera rostochiensis_ [Gr] and _G. pallida_ (both on the EPPO A2 list): potato cyst nematodes are widespread in Valle d'Aosta, and all tested samples collected from 10 potato fields were found positive. Grapevine yellows: so far, only bois noir (stolbur phytoplasma) is present in Valle d'Aosta. Although the insect vector _Scaphoideus titanus_ was trapped in numerous places, Grapevine flavescence doree phytoplasma (EPPO A2 list) has never been detected in vineyards. Source: Rapport d'activite 2002. Service phytosanitaire de l'arboriculture fruitiere et des cultures. Region autonome de la Vallee d'Aoste, 142 pp. ------------------------------ ProMED-mail [Valle d'Aosta is located north west of Torino. Both APP and stolbur phytoplasma are present in established woody plants. Of the 3 bacterial pathogens, Cms and Rs are of most concern, and their absence in Valle d'Aosta is good news for potato producers. Potato cyst nematodes are common in many other countries. Management of these pests is crucial, because crop losses can range from 20 to 70 per cent. Presence of the golden nematode (Gr) in potato-growing areas precludes export of potatoes to international markets because of restrictions imposed by many countries against this pest. - Mod.DH] .........................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jan 19 15:06:53 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Potato spindle tuber viroid, tomato - United Kingdom Message-ID: <37llo3vbia.fsf@lios.aq2.gweep.ca> POTATO SPINDLE TUBER VIROID, TOMATO - UNITED KINGDOM **************************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 15 Jan 2004 From: ProMED-mail Source: British Society of Plant Pathology, New Disease Reports, vol 8 [edited] The 1st report of potato spindle tuber viroid (PSTVd) in commercial tomatoes in the UK ----------------------------------------------- RA Mumford , B Jarvis, A Skelton (Central Science Laboratory, Sand Hutton, York, YO41 1LZ, UK). Accepted for publication 15 Dec 2003. In July 2003, samples were received from a glasshouse tomato crop in south east England. The samples were sent following the appearance of virus-like symptoms in a few plants of variety 'Passion'. Affected plants showed a range of symptoms including yellowing, leaf curling, and epinasty, in addition to whole plant stunting and bunching of stems in the crown ('bunchy top'). Given the symptoms, the samples were tested for potato spindle tuber pospiviroid (PSTVd) using a TaqMan reverse transcriptase-polymerase chain reaction (RT-PCR) assay (Mumford et al, 2000) and all samples tested positive. Moreover, samples collected earlier in the crop tested positive in enzyme linked immunosorent assay (ELISA) for Pepino mosaic potexvirus (PepMV). To confirm the TaqMan results, certain samples were tested further by RT-PCR using primers known to detect a range of different pospiviroids (Mumford et al, 2000; Mumford, 2002) and a product of the predicted size (264 bases) was obtained. Using RT-PCR with a 2nd primer set (PSTVd 133F CCCACCGCGCCTTTTGCCAG and PSTVd 134R GAGTGCCTCGCGGCCGAG), a full-length product of 358 bases was obtained. This was sequenced (Acc. No. AJ583449) and shown to share very high sequence similarity (over 89 per cent) with all published PSTVd sequences. The closest homology (99.4 per cent similarity) was with an isolate recently identified in tomato from New Zealand (Acc. No. AF369530). Following confirmation of PSTVd infection, the crop was extensively screened both by visual assessment and laboratory testing. About 80 infected plants tested positive for PSTVd presence, within an area of the crop containing around 69 000 plants. The origin of the infection is unknown, but the crop has now been removed and measures were taken that eradicated the infection. While PSTVd has previously been found under controlled conditions in a potato germplasm collection in the UK (Cammack & Harris, 1973), this is the 1st report of an outbreak in a commercial crop. References Cammack RH, Harris PS. Potato spindle tuber in the Commonwealth Potato Collection. EPPO Bulletin 1973; 3: 117-8. Mumford RA. Protocols for the diagnosis of Quarantine pests: Chrysanthemum stunt viroid. EPPO Bulletin 2002; 32: 245-53. Mumford RA, Walsh K, Boonham N. A comparison of molecular methods for the routine detection of viroids. EPPO Bulletin 2000; 30: 431-6. ------------------------------ ProMED-mail [PSTVd is a nasty pathogen. Disease management depends upon adherence to a strict phytosanitary regimen to prevent contamination and subsequent spread of the viroid. Benches, tools, storage bins, and sacks can be disinfected with 3 per cent hypochlorite. I had heard comments about PSTVd in potato while I was on leave to the Scottish Horticultural Research Institute, Dundee in 1978, and I am glad to see the reference by Cammack and Harris. A comment I had made regarding the 1st instance of PSTVd was in error; the 1st instance of PSTVd infection was in the Commonwealth Potato Collection, reported in 1973. The current infection is the second occurrence of the disease in the UK, this time in a commercial crop. - Mod.DH] [see also: 2003 --- Potato spindle tuber viroid, tomato - United Kingdom 20030909.2268 Potato spindle tuber viroid, eradication - France 20030814.2021 Potato spindle tuber viroid - Canada: eradication 20030806.1928 Potato spindle tuber, tomato - Australia: eradication 20030804.1913 Potato spindle tuber, tomato - Australia (NSW) (02) 20030620.1516 Potato spindle tuber, tomato - Australia (NSW) 20030618.1506 2002 --- Potato spindle tuber viroid, potato - France 20021011.5520 2001 --- Potato spindle tuber viroid, tomatos - Australia 20010622.1186 Potato spindle tuber viroid - New Zealand 20010314.0514 2000 --- Potato spindle tuber viroid - Costa Rica 20000221.0236] ............................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jan 19 15:07:00 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Powdery mildew, Podosphaera sp., cowpea - Turkey Message-ID: <37hdyrvbi3.fsf@lios.aq2.gweep.ca> POWDERY MILDEW, PODOSPHAERA SP., COWPEA - TURKEY ************************************************ A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 17 Jan 2004 From: ProMED-mail Source: British Soc Plant Pathol, New Disease Reports, Vol. 8 [edited] First report of powdery mildew caused by _Podosphaera phaseoli_ (syn. _Sphaerotheca phaseoli_) on cowpea (_Vigna sinensis_ L.) in Turkey. EM Soylu, S Soylu , S Kurt (Department of Plant Protection, University of Mustafa Kemal, Faculty of Agriculture, 31034 Hatay, Turkey). Accepted for publication 7 Jan 2004. During the summer of 2003, typical symptoms of powdery mildew were observed in many cowpea fields in Hatay Province, Turkey. White, epiphytic mycelia and conidia, characteristic of a powdery mildew, were present on leaves, stems, and inflorescences. The plant tissue underneath the mycelial patches was purplish in colour. Mycelial growth was amphigenous, thick, forming irregular white patches, sometimes effused to cover the whole leaf surface and had a poorly developed nipple-shaped single appressorium. Simple straight conidiophores (115-190 x 10-13 micrometers) developed mostly singly from a hyphal cell, arising from the upper part of mother cells, and having the basal septum at the branching point of the mycelium with a sharp constriction. Each conidiophore had 3 to 8 barrel-shaped conidia formed in a chain. Conidia with fibrosin bodies were 28-42 x 15-18 micrometers in size and germinated below the shoulder by producing a simple germ tube. Dark brown ascomata, found on leaves and stems as embedded in the mycelial felt, were spherical, gregarious to subscattered and measured 85 to 105 micrometers in diameter. Appendages (6 to 15) were myceloid, arising from the lower half of the ascomata, brown, paler upward and 6 to 8 micrometers wide. The ascomata contained single ascus (65-95 x 55-67 micrometers). The ascus contained 8 ellipsoidal to ovoid ascospores (18-24 x 12-16 micrometers). On the basis of morphological characters of the conidial stage and teleomorph, the fungus was identified as _Podosphaera phaseoli_ [Pp] (syn. _Sphaerotheca phaseoli_) (Braun & Takamatsu, 2000; Shin, 2000). Pathogenicity tests were conducted on 4-week-old cowpea plants, cv. Libye, by shaking fresh conidia from naturally infected plants onto healthy leaves. Inoculated plants were kept in a moist chamber (100 per cent RH) for 2 days and then maintained in a growth chamber at 22 ? 2 deg C, 75 per cent RH with a 16 h photoperiod. After 7 to 10 days, inoculated plants developed powdery mildew symptoms similar to those observed on naturally infected plants. This is the first report of powdery mildew on cowpea in Turkey. Previous reports list Pp on _Vigna_ spp. in Korea (Shin & La, 1992; Lee et al., 2002). Pp was also reported on several related host plants such as _Phaseolus spp_. and _Rhynchosia volubilis_ (Shin, 2000). Although bean is one of the alternate hosts of Pp and grown in nearby cowpea plants in the same field, no disease symptoms were observed on bean. References Braun U, Takamatsu S. Phylogeny of Erysiphe, Microsphaera, Uncinula (Erysipheae) and Cystotheca, Podosphaera, Sphaerotheca (Cystotheceae) inferred from rDNA ITS sequences - some taxonomic consequences. Schlechtendalia 2000; 4: 1-33. Lee SY, Hwang SJ, Lee SB. Occurrence of powdery mildew on mung bean (Vigna radiata L.) caused by Sphaerotheca phaseoli. Research in Plant Disease 2002; 8: 166-70. Shin HD. Erysiphaceae of Korea. Suwon, Korea: Nat Inst Agric Scie Tech, 2000. Shin HD, La YJ. Addition to the new records of host plants of powdery mildews in Korea. Korean Journal of Plant Pathology 1992; 8: 57-60. ------------------------------ ProMED-mail [I could not find any information relevant to this disease or its management. The disease has not been reported previously in ProMED-mail; this piece is being posted for the record. Further information would be welcomed. - Mod.DH] ...........................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Jan 22 11:24:54 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Cucumber vein yellowing virus, cucurbits - Portugal Message-ID: <37brovlu2y.fsf@lios.aq2.gweep.ca> CUCUMBER VEIN YELLOWING VIRUS, CUCURBITS - PORTUGAL ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 20 Jan 2004 From: ProMED-mail Source: British Soc. Plant Pathol., New Disease Reports Vol. 8 [edited] Occurrence of Cucumber vein yellowing virus in cucurbitaceous species in southern Portugal D. Louro [1] (Estacao Agronomica Nacional, INIAP, Quinta do Marques, 2784-505 Oeiras, Portugal; A. Quinot (as for Louro [2]); E. Neto (Direccao Regional de Agricultura do Algarve, Apart. 282, 8001-904 Faro, Portugal); J. E. Fernandes (as for Neto); D. Marian (Istituto di Virologia Vegetale, CNR, Strada delle Cacce 73, 10135 Torino, Italy); M. Vecchiati (as for Marian); P. Caciagli (as for Marian); A.M. Vaira . Accepted for publication 15 Dec 2003. Cucumber vein yellowing virus (CVYV), a tentative member of the genus Ipomovirus (Family Potyviridae) (Lecoq et al., 2000), has caused severe diseases in cucurbits in the East Mediterranean Basin for over 4 decades (Cohen & Nitzany, 1960). Recently, it was detected in Spain both in cultivated cucurbits and weeds (Cuadrado et al., 2001; Janssen et al., 2002). During the summer of 2002 in Algarve (southern Portugal), vein yellowing, stunting and sudden plant death were observed in protected melons (_Cucumis melo_), heavily infested by _Bemisia tabaci_. Watermelons (_Citrullus lanatus_) grown nearby showed mild leaf chlorosis and split fruits with internal necrosis; cucumbers (_Cucumis sativus_) and squashes (_Cucurbita pepo_) showed vein clearing and mottling on leaves. 15 of 52 field samples, belonging to the 4 species, were shown to be infected with CVYV when tested by RT-PCR with specific primers (Cuadrado et al., 2001) by a one-step procedure. Most samples were also infected with Cucurbit yellow stunting disorder virus (CYSDV), another whitefly-borne virus endemic in the region, but were free from other viruses commonly infecting cucurbits. One CVYV isolate from cucumber was experimentally transmitted to zucchini (_Cucurbita pepo_) by _B. tabaci_ in the semi-persistent manner. From field samples, CVYV was mechanically transmitted to known host species of the virus. All transmissions were confirmed by RT-PCR. 4 amplified fragments, one from each species, were sequenced, showing 100 percent identity with each other, and the 449-bp sequence of a CVYV isolate from cucumber was submitted to GenBank (AY424869). The sequence showed 99 percent identity with the isolate AM48 from Spain (AY290865) and 96 percent with an isolate from Israel (AF233429). Surveys during the summer of 2003 confirmed the presence of CVYV in cucurbits in the same area. The actual impact of CVYV in the local pathosystem cucurbits/whitefly-borne viruses has yet to be determined. This is the first report of the occurrence of CVYV in Portugal. References: Cohen S, Nitzany FE, 1960. A whitefly-transmitted virus of cucurbits in Israel. Phytopathologia Mediterranea 1, 44-46. Cuadrado IM, Janssen D, Velasco L, Ruiz L, Segundo E, 2001. First report of Cucumber vein yellowing virus in Spain. Plant Disease 85, 336. Janssen D, Ruiz L, Velasco L, Segundo E, Cuadrado IM, 2002. Non-cucurbitaceous weed species shown to be natural hosts of Cucumber vein yellowing virus in south-eastern Spain. New Disease Reports [] Volume 5. Lecoq H, Desbiez C, Delecolle B, Cohen S, Mansour A, 2000. Cytological and molecular evidence that the whitefly-transmitted Cucumber vein yellowing virus is a tentative member of the family Potyviridae. Journal of General Virology 81, 2289-2293. ------------------------------ ProMED-mail [CVYV, first reported from Israel in 1960, has subsequently spread within the EPPO region (Israel, Jordan, Portugal, Spain, Turkey) and Sudan. The disease affects cucumber, pumpkin, squash, and watermelon. CVYV wreaks havoc on cucurbit hosts in the eastern Mediterranean region, causing considerable crop loss. Information on disease management is meager. Attempts to reduce losses center on use of virus-free seedlings, provision of screens in glasshouse production systems to prevent viruliferous whiteflies (_B. tabaci_) from feeding on plants, use of chemical insecticides, implementing a period of at least a month between seeding new crops, and biological control using predacious insects (_Encarsia formosa_), a parasitic wasp, and the beetle _Delphasutus pusillus_. The fact that cucumber vein yellowing disease is present across the southern flank of Europe is of concern to plant pathologists and entomologists. - Mod.DH] 2002 ---- Cucumber vein yellowing virus, cucurbits - Spain 20020111.3226] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Jan 22 16:47:42 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Non-compliance, EPPO regulated pests Message-ID: <37ptdbeeap.fsf@lios.aq2.gweep.ca> NON-COMPLIANCE, EPPO REGULATED PESTS ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 21 Jan 2004 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 11 [edited] 2003/175 EPPO report on notifications of non-compliance (detection of regulated pests) The EPPO Secretariat has gathered the notifications of non-compliance for 2003 received since the previous report (EPPO RS 2003/124) from the following countries: Algeria, Austria, Denmark, France, Finland, Germany, Guernsey [a British crown dependency in the Channel Islands, close to the coast of France], Ireland, Italy, Lithuania, Netherlands, Poland, Portugal, Slovenia, Sweden, Switzerland, United Kingdom. When a consignment has been re-exported and the country of origin is unknown, the re-exporting country is indicated in brackets. When the occurrence of a pest in a given country is not known to the EPPO Secretariat, this is indicated by an asterisk (*). The EPPO Secretariat has selected notifications of non-compliance made because of the detection of regulated pests. Other notifications of non-compliance due to prohibited commodities, missing or invalid certificates are not indicated. It must be pointed out that the report is only partial, as many EPPO countries have not yet sent their notifications. Pest/ Consignment/ Type of Commodity/ Country of origin/ Country of destination/ Number [of cases] BACTERIAL PATHOGENS: _Clavibacter michiganensis_ subsp. _michiganensis_, _Lycopersicon esculentum_, Seeds, India, France 1 FUNGAL PATHOGENS: _Guignardia citricarpa_ [Gc], _Citrus limon_, Fruits, South Africa, Netherlands 2 Gc, _C.reticulata_, Fruits, Argentina, Netherlands 1 Gc, _ C. sinensis_, Fruits, Argentina, Netherlands 1 Gc, _C. sinensis_, Fruits, Brazil, Netherlands 1 _Monilinia fructicola_, _Prunus_, Fruits, China*, United Kingdom 1 NEMATODE PATHOGENS: _Globodera rostochiensis_, _Solanum tuberosum_, Ware potatoes, Poland, Slovenia 1 PHYTOPLASMAL PATHOGENS: Pear decline phytoplasma, _Pyrus_, Plants for planting, Netherlands, Germany 1 VIRAL PATHOGENS: Pepino mosaic potexvirus [PepMV], _Lycopersicon esculentum_, Seeds, Netherlands, United Kingdom 1 PepMV, _Lycopersicon esculentum_, Vegetables, Netherlands, United Kingdom 1 PepMV, _Lycopersicon esculentum_, Vegetables, Spain, United Kingdom 2 PepMV, _Lycopersicon esculentum_, Vegetables, Spain, (Canary Isl.), Finland 2 Source: EPPO Secretariat, 2003-11. ------------------------------ ProMED-mail [3 pathogens are of interest in this report. _Guignardia citricarpa_ causes citrus black spot disease, one of the most serious citrus diseases affecting citrus production in South America, Africa, and Australia. Black spot affects all commercial citrus cultivars and is particularly severe in lemon. The disease is particularly virulent late in the season, and postharvest losses can also occur. The second pathogen, Pepino mosaic virus (PepMV), is extremely infectious and spreads very rapidly, especially in glasshouse operations. The main modes of transmission are grafting, contamination of workers' tools and hands, and direct contact between plants. _Globodera rostochiensis_ affects potato and is distributed widely in Europe, India, North Africa, Asia, South America, and New York State in USA. Note that _Monilinia fructicola_ was unknown in China until this report. These reports of non-compliance are an important measure of the effectiveness of the monitoring for plant diseases of major food crops in commercial trading. - Mod.DH] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Tue Jan 27 13:27:49 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Beet pseudoyellows virus, pumpkin - USA (CA) Message-ID: <374quh3zne.fsf@lios.aq2.gweep.ca> BEET PSEUDOYELLOWS VIRUS, PUMPKIN - USA (CALIFORNIA) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 23 Jan 2004 From: ProMED-mail Source: American Phytopathological Society, Plant Disease Notes [edited] Pumpkin (_Cucurbita maxima_ and _C. pepo_), a new host of Beet pseudo yellows virus in California. W. M. Wintermantel, USDA-ARS, 1636 E. Alisal Street, Salinas, CA 93905. Plant Dis. 88:82, 2004; published on-line as D-2003-1031-02N, 2004. Accepted for publication 3 Oct 2003. In the summer of 2002, pumpkin plants (_Cucurbita pepo_ L. and _C. maxima_ Duchesne) with extensive leaf chlorosis similar to those observed in crinivirus infections were found in fields at 2 locations in Monterey County, California. Leaves of diseased plants were observed to have large populations of the greenhouse whitefly (_Trialeurodes vaporariorum_) present. Double-stranded RNA was extracted from symptomatic leaves of these plants and tested by northern hybridization for numerous criniviruses. A positive signal was identified exclusively with probes against the HSP70h gene of Beet pseudo yellows virus (BPYV) and confirmed by reverse transcription-polymerase chain reaction (RT-PCR) amplification of a 335-nucleotide section of the BPYV minor coat protein (CPm) gene (3). Similar symptoms were observed in additional fields in 2003, and BPYV was again confirmed. In addition, the CPm RT-PCR product was cloned into a TOPO pCR2 vector (Invitrogen, Carlsbad, CA) and sequenced. BLAST analysis of the cloned CPm RT-PCR product sequence corresponded to the published sequence of the CPm gene of BPYV (98 percent) (3) and Cucumber yellows virus (CuYV), a recently sequenced crinivirus considered to be a strain of BPYV (97 percent) (2). Incidence of BPYV in pumpkin appears to be variable and probably corresponds to the incidence of viruliferous whiteflies. On the basis of foliar symptoms, BPYV incidence varied from less than 50 percent in these fields in 2002 to nearly 100 percent infection of a large commercial field in 2003. BPYV is transmitted semipersistently by the greenhouse whitefly and has an extensive host range (1). The virus causes economic losses worldwide for greenhouse vegetable production and is becoming an increasing problem for field crops in areas of high greenhouse whitefly incidence (3). The impact of BPYV on pumpkin production remains to be determined; however, grower data suggest an increased incidence of fruit abortion and a substantial decrease in fruit weight. To our knowledge, this is the first report of BPYV infecting pumpkin. References: (1) J. E. Duffus. Phytopathology 55:450, 1965. (2) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (3) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. ------------------------------ ProMED-mail [1st reported in beet (_Beta vulgaris_) from Salinas, CA, in 1965, BPYV is spreading in Australia (Tasmania), France, Japan, the Netherlands, USA (California), and more recently reported from Italy, Crete, and possibly Spain. It would appear to be an emerging disease of pumpkin and perhaps other cucurbits monitored by ProMED-Plant. - Mod.DH] [see also: ] 2003 ---- Beet pseudoyellows virus, melon - Italy: first report 20030904.2221 2001 ---- Beet pseudoyellows virus, cucumber - New Zealand 20011116.2823] ..................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Tue Jan 27 13:27:58 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Monosporascus sp., vine decline, melon - Brazil Message-ID: <37znc92l2p.fsf@lios.aq2.gweep.ca> MONOSPORASCUS SP., VINE DECLINE, MELON - BRAZIL ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 26 Jan 2004 From: ProMED-mail Source: American Phytopathological Society, Plant Disease Notes [edited] 1st Report of _Monosporascus cannonballus_ on Melon in Brazil. ----------------------------------------------------- R. Sales Jr., I. J. Bezerra do Nascimento, and L. de Souza Freitas, Escola Superior de Agricultura de Mossoro, ESAM, Caixa Postal 137, 59.600- 970, Mossoro-RN, Brazil; and R. Beltran, J. Armengol, A. Vicent, & J. Garcia-Jimenez, Instituto Agroforestal Mediterraneo, Universidad Politecnica de Valencia, Camino de Vera s/n, 46022-Valencia, Spain. Plant Dis. 88:84, 2004; published on-line as D-2003-1105-01N, 2004. Accepted for publication 10 Oct 2003. Approximately 15 000 ha of melon (_Cucumis melo_ L.) are grown in the northeastern section of Brazil, mostly for export to Europe during the winter months. Surveys for melon vine decline diseases were carried out in farms in the municipalities of Mossoro (Rio Grande do Norte) and Quixere (Ceara) during 2002 and 2003. Symptoms typical of vine decline were observed in several fields and included yellowing of crown leaves just prior to harvest and collapse of many of the vines. Affected plants exhibited necrotic root systems and lacked most of the secondary and tertiary feeder roots. Numerous perithecia were observed on roots which, when examined with a microscope, showed characteristic asci and ascospores of the fungus _Monosporascus cannonballus_ (Pollack & Uecker, ref. 2). Isolations were made from the crown region and primary and secondary roots of affected plants by excising 4- to 6-mm pieces that were surface-sterilized for 30 to 60 s with 1.5 percent active chlorine solution. 7 tissue pieces from each plant part were placed on potato dextrose agar (PDA) containing 0.5 g liter -1 of streptomycin sulfate. Plates were examined daily for fungal growth for 7 days, and hyphal tips from all colonies were transferred to PDA for subsequent growth and sporulation. _M. cannonballus_ was isolated from 50 percent of the root sections. All isolates produced only one ascospore per ascus. Pathogenicity of 4 isolates was confirmed in the greenhouse on the muskmelon cv. Temprano Rochet. Inoculum was produced in a sand-oat hulls (_Avena sativa_ L.) medium (0.5 liter of sand, 46 g of ground oat hulls, and 37.5 ml of distilled water) and incubated at 25 deg C for 1 month. Colony forming units (CFU) were quantified by serial dilution using 1 percent hydroxyethyl cellulose. A sterilized mixture of equal portions (vol/vol) of sand and peat moss was used to fill plastic pots (17 cm in diameter), and inoculum was added to produce an inoculum concentration of 20 CFU/g. 5 melon seeds were planted in each pot and after germination, were thinned to one seedling per pot. There were 5 replicated pots for each treatment with an equal number of uninfested pots. Plants were evaluated for disease 45 days after sowing. Roots were exposed by carefully washing the potting mix away. All isolates of _M. cannonballus_ tested were highly aggressive and caused severe root necrosis compared with the noninoculated control plants. _M. cannonballus_ was reisolated from symptomatic plants, confirming Koch's postulates. Double-cropping in the same fields for several years has created serious problems in Brazil, which are related to this soilborne pathogen that also causes root rot and vine decline of watermelon (_Citrullus lanatus_ (Thunb.) Matsum. & Nakai) worldwide (1). To our knowledge this is the first report of _M. cannonballus_ in Brazil and South America. References: (1) R. D. Martyn and M. E. Miller. Plant Dis. 80:716, 1996. (2) F. G. Pollack and F. A. Uecker. Mycologia 66:346, 1974. ------------------------------ ProMED-mail [This is the 1st report of the disease in Brazil. Management of _Monosporascus_ root rot is difficult. First reported in Arizona in 1974, it has subsequently been reported from the EPPO region: Israel (as _M. eutypoides_ [Me]), Italy, Libya (as Me) Spain and Tunisia; Asia: India, Iran (as Me), Japan, Pakistan (as Me), Saudi Arabia and Taiwan; and North America: Mexico, USA (Arizona, California, Texas) and Central America: Guatemala and Honduras. The fungus is soilborne, its ascospores are heavily walled and thus can remain viable for many years, and there are few resistant or tolerant cultivars. Management options include chemical soil treatment (which is becoming increasingly less popular because of environmental concerns) and grafting of susceptible melons and watermelons onto rootstocks of some resistant hosts ( _Cucurbita_ spp.) or bottle gourd (_Lagenaria_ spp.). Biological control is being attempted by infecting wild-type fungal isolates of the pathogen with hypovirulent isolates containing dsRNAs so as to convert wild type isolates to a less aggressive form. - Mod.DH] [see also: 2000 ---- Melon root rot - USA (California): EPPO report 20001228.2290 Vine decline, watermelon - USA (Indiana) 20000901.1475 Melon wilt: control 20000527.0850 1999 ---- EPPO alert list, part 2/5: August 1999 19991027.1949] .......................................dh/pg/jw *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Tue Jan 27 13:27:23 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Phytophthora sp., root and foot rot, tomato - Belgium Message-ID: <378yjt3zo6.fsf@lios.aq2.gweep.ca> PHYTOPHTHORA SP., ROOT AND FOOT ROT, TOMATO - BELGIUM ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 22 Jan 2004 From: ProMED-mail American Phytopathological Society, Plant Disease Notes [edited] Root and Foot Rot on Tomato Caused by _Phytophthora infestans_ Detected in Belgium. B. Lievens, I. R. M. Hanssen, and A. C. R. C. Vanachter, Scientia Terrae Research Institute, Fortsesteenweg 30A, B-2860 Sint-Katelijne-Waver, Belgium; B. P. A. Cammue, Centre of Microbial and Plant Genetics (CMPG), Katholieke Universiteit Leuven, Kasteelpark Arenberg 20, B-3001 Leuven, Belgium; and B. P. H. J. Thomma, Wageningen University, P.O. Box 8025, 6700 EE Wageningen, the Netherlands. Plant Dis. 88:86, 2004; published on-line as D-2003-1110-01N, 2004. Accepted for publication 21 Oct 2003. In January 2003, a severe root and foot rot was observed on 2-month-old wilted tomato (_Lycopersicon esculentum_ Mill.) plants in a large-scale (2.5 ha) commercial greenhouse setting in Belgium. Tomato plants (10 percent) produced from healthy nursery-grown seedlings and planted to new, clean rockwool and drip irrigation with UV-disinfected water developed symptoms. Symptom development was restricted to lower plant parts with severe rotting of the entire root system and dark lesions girdling the stem base. No symptoms of disease were observed on the foliage or upper stems. Cross-sections of the stem base revealed brown discoloration of internal tissue, including the vascular tissue and pith. Dark brown lesions also occurred on the roots. Sections of the stem base, the upper roots (sampled near to the stem base), and the lower roots (sampled on roots deeper in the rockwool) were plated separately on corn meal agar. The oomycete pathogen _Phytophthora infestans_ (Mont.) de Bary was identified in each sample on the basis of morphological characteristics observed directly with light microscopy. Branched sporangiophores with slight swellings and characteristic lemon-shaped sporangia (35-20 micrometers and ratio length/width of 1.75 micrometers) at their tips were obvious after incubation in darkness at 24 deg C. Oospores and chlamydospores were not observed. After multiple soil treatment with oomycete-specific fungicides, the plants recovered. Since the occurrence of _P. infestans_ on roots is unusual, the identity of the pathogen on the diseased plant tissues was confirmed with 3 techniques, DNA array identification, internal transcribed spacer (ITS) sequencing, and a polymerase chain reaction (PCR) amplification using _P. infestans_-specific primers. DNA was directly processed from separate samples of upper and lower root and stem base tissue. The DNA array used was originally developed to detect and identify the key fungal pathogens of tomato (2). Among detector probes for other tomato pathogens, this array contains oligonucleotide detector probes for _P. infestans_ (PIN1: 5'-GGT TGT GGA CGC TGC TAT T and PIN2: 5'-AAT GGA GAA ATG CTC GAT TC). These probes are based on ITS sequences (ITS I and ITS II). Using conserved ribosomal primers OOMUP18Sc (5' TGC GGA AGG ATC ATT ACC ACA C) ITS4, oomycete DNA was amplified by PCR and simultaneously labeled with alkaline-labile digoxigenin (2). All generated amplicons strongly hybridized to the oligonucleotide detector probes for _P. infestans_ and not to any other pathogen-specific detection probe present in the array. The pathogen could not be detected in roots or stem bases of symptomless plants. In addition, the ITS-region was sequenced and showed 100 percent homology with multiple GenBank accessions of _P. infestans_ sequences. As a third confirmatory test, a PCR was performed on DNA extracts from infected root and stem base tissues using a primer set specific to _P. infestans_ (O8-3/O8-4 [1]). A band of the expected size was produced for the infected stem base and root samples. Until now, this pathogen was known worldwide to cause late blight on potatoes and tomatoes. To our knowledge, this is the first report of root and foot rot of tomato caused by _P. infestans_. ------------------------------ ProMED-mail [This is an interesting development. It is unusual that there were no disease symptoms associated with the foliage or upper stems. The fact that the ITS region of the glasshouse isolate of _P. infestans_ [Pi] is identical to that of a wide array of Pi isolates suggests a mutation in another region of the fungal genome. Unusual environmental conditions may have contributed to this anomaly. Pi has been around for a long time, and we are now aware of a new facet of its biology. Perhaps our readers would care to offer their comments. - Mod.DH] [see also: 2003 ---- Potato late blight, potato - Canada (Newfoundland) 20020818.5091 2001 ---- Phytophthora infestans, potato late blight - Russia 20010430.0840 Phytophthora infestans, potato late blight - Russia 20010620.1177 2000 ---- Potato late blight, global research efforts 20001031.1903 Potato late blight, etiology: Correction 20000330.0473 Potato late blight, etiology 20000325.0432 Plant pathogens, intercepts, EPPO (03) 20000513.0745] ......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Jan 29 15:06:43 2004 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:14:01 2005 Subject: PRO/PL> Brown rust, sugar cane - Australia (WA) Message-ID: <37ektih0jw.fsf@lios.aq2.gweep.ca> BROWN RUST, SUGAR CANE - AUSTRALIA (WA) *************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 26 Jan 2004 From: ProMED-mail Source: 22 Jan 2004, Australian Broadcasting Corp., Rural News [edited] Brown rust disease discovered in Western Australia -------------------------------------------------- The fungal disease brown rust has been discovered on sugar cane farms in the Ord River district, in Western Australia. The Department of Agriculture's Bill Webb says the disease is common in other cane-growing regions around the world and Australia, but this is the first time it's been discovered in WA's Kimberley region. He says he's confident the industry will be able to manage the disease. According to Webb, the only permanent disease management strategy is the use of resistant cultivars. Short-term spraying options are available, but they are of doubtful economic viability. ------------------------------ ProMED-mail [In addition to Australia, sugarcane brown rust (a.k.a. sugarcane orange rust) occurs in USA, Ecuador, Colombia, Mauritius and perhaps elsewhere. In Australia, the disease has been confirmed on sugarcane in most of the 18 sugarcane farms in the Ord district of the Kimberley region. The causal pathogen is _Puccinia melanocephala_. The best means of disease management is to grow resistant cultivars, but resistance is often unstable in some cultivars, presumably because of variants of the pathogen. Farmers are encouraged to diversify their varieties to minimize damage. Sulfur is often used for control of rust on sugarcane, but that option is not effective in the long run. Another strategy is to avoid planting susceptible cultivars. The French plant research agency CIRAD is actively searching for candidate resistance genes. Useful references: - Mod.DH] [see also: 2001 ---- Puccinia sp., sugarcane orange rust - Australia (Qd) 20010225.0365] ................................mpp/dh/pg/jw *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################