From brian at gweep.ca Wed Nov 5 17:59:37 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:58 2005 Subject: PRO/PL> Squash leaf curl China virus - Philippines: new strain Message-ID: <37brrqmhvq.fsf@lios.aq2.gweep.ca> SQUASH LEAF CURL CHINA VIRUS - PHILIPPINES: NEW STRAIN ****************************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 3 Nov 2003 From: ProMED-mail Source: J Phytopathol 2003 (Oct); 151(10): 535 [edited] Molecular characterization of a strain of squash leaf curl China virus from the Philippines -------------------------- T Kon, S Hase, H Takahashi, M Ikegami (Department of Life Science, Graduate School of Agricultural Science, Tohoku University, Sendai 981-8555, Japan), LM Dolores, NB Bajet (University of the Philippines, Los Banos, Philippines) The complete nucleotide sequence of infectious cloned DNA components (A and B) of the causal agent of squash leaf curl disease in the Philippines was determined. DNA-A and DNA-B comprise 2739 and 2705 nucleotides, respectively; the common region is 174 bases in length. 5 ORFs were found in DNA-A and 2 in DNA-B. Partial dimeric clones containing DNA-A and DNA-B, constructed in a binary vector and transformed into _Agrobacterium tumefaciens_, induced systemic infection in agro-inoculated pumpkin plants (_Cucurbita moschata_). The total DNA-A sequence was most closely related to that of squash leaf curl China virus (SLCCNV) (88 per cent identity), although the existence of B component of SLCCNV has not been reported. The deduced coat protein was like that of SLCCNV (98 per cent amino acid sequence identity) and the Philippines virus has low sequence identity to squash leaf curl virus (SLCV) and squash mild leaf curl virus (SMLCV) (63 and 64 per cent total nucleotide sequence identities, respectively). From these results, we propose that the Philippines virus be designated squash leaf curl China virus-[Philippines] (SLCCNV-[PH]). ------------------------------------------------------------------------ ProMED-mail [The evolution of the Philippines strain is not unexpected, as new strains are constantly emerging. In addition to Squash leaf curl Philippines virus, there are 2 other strains -- SLCV (type strain) and Squash leaf curl China virus (Yunnan). Squash leaf curl begomovirus (SLCV) is transmitted by 2 whitefly species -- the sweet potato whitefly _Bemisia tabaci_ and the silverleaf whitefly, _B. argentifolii_ -- although some taxonomists suggest that these species are really biotypes. Squash and watermelon are preferred hosts. Disease management utilizes cultural control (eradication of infected plants, use of UV-absorbing greenhouse plastic films, and aluminum plastic mulches) and biological control (use of parasitoids such as _Encarsia_ and _Eretmocerus_ spp). Use of insecticides is not very efficacious because whiteflies tend to congregate on the undersides of leaves. References: - Mod.DH] [see also: 2002 --- Calopogonium sp., Phaseolus vulgaris - Costa Rica 20020208.3510 2001 --- EPPO Alert List: New Listings (02) 20011201.2923] .........................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Nov 10 11:21:05 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> East African cassava mosaic virus, UG var. - Burundi Message-ID: <37fzgw13vz.fsf@lios.aq2.gweep.ca> EAST AFRICAN CASSAVA MOSAIC VIRUS, UG VARIANT - BURUNDI ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 7 Nov 2003 From: ProMED-mail Source: British Soc. Plant Pathol., New Disease Reports, Vol. 8 [edited] 1st evidence for the spread of East African cassava mosaic virus -- Uganda (EACMV-UG) and the pandemic of severe cassava mosaic disease to Burundi S. Bigirimana (Institut des Sciences Agronomiques du Burundi, Gitega, Burundi); P. Barumbanze (as for isabu-getega); R. Obonyo (International Institute of Tropical Agriculture, Eastern and Southern Africa Regional Centre, Kampala, Uganda); J.P. Legg (as for Obonyo); and J.P Legg (Natural Resources Institute, Chatham Maritime, UK). Accepted for publication 27 Oct 2003. Cassava mosaic disease (CMD) is the most important constraint to cassava (_Manihot esculenta_) production in Africa. Since the 1990s, the importance of the disease has been greatly increased by the spread through East and Central Africa of a pandemic of unusually severe CMD (Legg, 1999), associated with the recombinant begomovirus, East African cassava mosaic virus -- Uganda (EACMV-UG) (Zhou et al., 1997). Following reports of the spread of EACMV-UG to Rwanda (Legg et al., 2001), it became apparent that Burundi, to the south, was also threatened. A survey of cassava plantings in Burundi was conducted in May/June 2003 to assess the status of CMD and to identify begomoviruses present. 53 fields were sampled in 10 of the country's 16 regions and CMD-diseased leaf samples collected in each field for virus diagnosis. Assessments were made of CMD incidence, severity (using the standard 1-5 scale), infection type (either cutting or whitefly-borne) and abundance of the whitefly vector, _Bemisia tabaci_ (Bt). Viruses were diagnosed from leaf samples using both specific primer PCR (Zhou et al., 1997) and restriction digestion with EcoRV and MluI of near full-length DNA-A fragments amplified using universal begomovirus primers (Briddon & Markham, 1994). EACMV-UG, ACMV, EACMV and mixed ACMV?UG infections were identified from 17, 34, 1 and 3 sites, respectively. EACMV-UG occurred at all sites in the north-eastern regions of Muyinga and Kirundo was present at some sites in northern Gitega, Ngozi, Karuzi, Kayanza, Ruyigi and northern Rutana, but was not recorded from southern Gitega, southern Rutana, Muramvya or Bujumbura. The EACMV-UG affected regions of Muyingo and Kirundo were distinct from the others in having higher CMD incidence (79 vs. 42 percent), a greater proportion of whitefly-borne to cutting-borne infection (1.9 vs. 0.6), more severe symptoms (4.17 vs. 3.26) and a greater abundance of Bt (4.9 vs. 1.0). This data set provides clear evidence for the rapid spread of severe EACMV-UG associated CMD in the north-eastern regions of Kirundo and Muyinga. The occurrence of EACMV-UG at sites in northern, central, and eastern Burundi also suggests that similar changes in CMD epidemiology are likely to occur here in the near future. These results represent the first report of the expansion of the African CMD pandemic into Burundi. References Briddon RW, Markham PG, 1994. Universal primers for the PCR amplification of dicot-infecting geminiviruses. Molecular Biotechnology 1, 202-5. Legg JP, 1999. Emergence, spread and strategies for controlling the pandemic of cassava mosaic virus disease in east and central Africa. Crop Protection 18, 627-37. Legg JP, Okao-Okuja G, Mayala R, Muhinyuza J-B, 2001. Spread into Rwanda of the severe cassava mosaic virus disease pandemic and associated Uganda variant of East African cassava mosaic virus (EACMV-Ug). Plant Pathology 50, 796. Zhou X, Liu Y, Calvert L, Munoz C, Otim-Nape GW, Robinson DJ, Harrison BD. 1997. Evidence that DNA-A of a geminivirus associated with severe cassava mosaic disease in Uganda has arisen by interspecific recombination. Journal of General Virology 78, 2101-2111. ------------------------------------------------------------------------ ProMED-mail [It was just a matter of time before CMD would be reported from Burundi. The most likely means of spread of EACMV-UG into Burundi would be via viruliferous whiteflies (_Bemisia tabaci_) and movement of infected cassava cuttings. CMD continues to spread. Research by scientists at the Centro Internacional de Agricultura Tropical (CIAT) in Colombia has resulted in the development and deployment of microsatellites or simple sequence repeat (SSR) markers which facilitate resistance breeding. SSR markers have been successfully applied in tagging cassava genome loci involved in resistance to CMD. Additional references: - Mod.DH] [see also: East African cassava mosaic Zanzibar virus - Kenya 20030408.0859 2002 ---- Cassava mosaic virus, Ugandan variant - Nigeria 20021207.6003 Cassava mosaic disease - East & Central Africa (02) 20020927.5416 Cassava mosaic disease - East & Central Africa 20020915.5321 2001 ---- Cassava diseases - Kenya 20011117.2829 East African cassava mosaic virus - West Africa 20010814.1920 East African cassava mosaic begomovirus 20010523.1003] .........................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Nov 12 20:55:32 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Black dot disease, potato, atypical lesions - France Message-ID: <37vfpoudl8.fsf@lios.aq2.gweep.ca> BLACK DOT DISEASE, POTATO, ATYPICAL LESIONS - FRANCE ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 11 Nov 2003 From: ProMED-mail Source: British Soc. Plant Pathol., New Disease Reports, Vol. 8 [edited] Deep sunken lesions: an atypical symptom on potato tubers caused by _Colletotrichum coccodes_ during storage I. Glais, Groupement National Interprofessionnel des Semences, 44 rue du Louvre, 75001 Paris; I. Glais , INRA-Centre de Rennes, UMR BiO3P, Domaine de la Motte, BP35327, F-35653 Le Rheu Cedex, France; and D. Andrivon (as for Glais, INRA) . Accepted for publication 20 Oct 2003 _Colletotrichum coccodes_ [Cc] causes a potato tuber-blemishing disease, commonly known as black dot. Typical black dot symptoms are silvery-to-brown patches on the tuber surface, bearing black microsclerotia (Dillard, 1992). Severe infection can cause tuber shrivelling (Hunger & McIntyre, 1979). Furthermore, Mooi (1959) attributed deep lesions observed on infected tubers stored at -1 deg C to Cc. Similar symptoms have also been occasionally observed on tubers kept in commercial cold stores under irregular temperature regimes (Gaucher, 1998). To our knowledge, these symptoms have never been reproduced in control inoculation experiments, so the implication of Cc as the sole causal agent remains unclear. Deep sunken lesions, similar to those reported by Mooi (1959) and Gaucher (1998), were obtained on potato tubers from commercial stores, that had been kept for several weeks at 5-15 deg C, after an artificial inoculation with Cc. The inoculation was performed by depositing a 10 microliter drop of a conidial suspension (calibrated at 3 million/ml) of Cc (isolate 91.22g from the INRA culture collection) on each end of healthy mini-tubers of potato cv. Charlotte. Water droplets without inoculum were used on control tubers. Inoculated tubers were incubated in the dark at 5, 10, and 15 deg C and 100 percent relative humidity (rh). After approximately 10 weeks of incubation, dark brown, irregular shaped lesions with clear contours were observed. Five months later, symptoms had extended over the whole tuber surface . Cc was the only pathogen isolated from these lesions. The proportion of tubers showing deep lesions was higher at 10 deg C (~ 20 percent), than at 5 or 15 deg C (~ 5 percent). These lesions were never observed on tubers inoculated in the same way but kept at 20-25 deg C and 100 percent rh. On these tubers only typical black dot symptoms developed. No lesions or black dot symptoms were observed on control tubers. These observations demonstrate that Cc alone can cause deep tuber lesions on potato tubers stored for extended periods at 5-15 deg C. References Dillard HR, 1992. Colletotrichum coccodes: the pathogen and its hosts. In: Bailey J.A., Jeger M.J., eds. Colletotrichum: Biology, pathology and control. Wallingford, UK: CAB International, 225-236. Gaucher D, 1998. La dartrose. In: Maladies de la pomme de terre. Paris, France: ITCF-ITPT, 33. Hunger RM, McIntyre GA, 1979. Occurrence, development, and losses associated with silver scurf and black dot on Colorado potatoes. American Potato Journal 56, 289-306. Mooi JC, 1959. A skin necrosis occurring on potato tubers affected by black dot (C. coccodes) after exposure to low temperatures. European Potato Journal 2, 58-68. ------------------------------------------------------------------------ ProMED-mail [Cc is a relatively weak pathogen of potato. The pathogen is soil-borne, residing in tubers and soil. Disease management is difficult because there are few available chemical fungicides and little or no resistance in current potato cultivars. Cultural procedures may offer some degree of disease control. -Mod.DH] An additional reference: ......................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Nov 12 20:56:02 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Cassava mosaic disease - Gabon: first report Message-ID: <37r80cudkd.fsf@lios.aq2.gweep.ca> CASSAVA MOSAIC DISEASE - GABON: FIRST REPORT ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 11 Nov 2003 From: ProMED-mail Source: British Soc. Plant Pathol., New Disease Reports, Vol. 8 [edited] 1st report of cassava mosaic disease and cassava mosaic geminiviruses in Gabon J.P. Legg, International Institute of Tropical Agriculture, Eastern and Southern Africa Regional Centre, Kampala, Uganda); J. Legg , Natural Resources Institute, Chatham Maritime, UK; F. Ndjelassili, Institut de Recherche Technologique, Libreville, Gabon; and G. Okao-Okuja (as for Legg, IITA). Accepted for publication 27 Oct 2003 Cassava mosaic disease (CMD), arguably Africa's greatest plant protection problem, has occurred in Central/West Africa for more than 70 years. There is, however, no published record of the occurrence of CMD or cassava mosaic geminiviruses (CMS) that cause it from the central African country of Gabon. However, the severe Uganda variant of East African cassava mosaic virus (EACMV-UG), associated with the African CMD pandemic, has been recorded from the Republic of Congo (Neuenschwander et al., 2002), bordering Gabon to the west. Cassava fields were examined at 55 sites throughout Gabon in April and July 2003, in order to identify the CMGs associated with CMD and to determine whether the pandemic-associated EACMV-UG was present. At each site, 30 plants were examined and assessments made of CMD incidence, symptom severity, and the abundance of the whitefly vector, _Bemisia tabaci_ (Genn.). At least 2 virus-diseased leaf samples were collected from each field for subsequent virus diagnosis. DNA was extracted from these samples on the day of collection (Dellaporta et al. 1983). Virus diagnoses were subsequently made from DNA samples using both specific primer PCR (Zhou et al., 1997) and RFLP analysis involving restriction digestion by EcoRV and MluI of near full-length DNA-A fragments amplified using abutting primer PCR with universal geminivirus primers (Briddon & Markham, 1994). ACMV was the most widely distributed CMG species, occurring at 53 of 55 sites. EACMV was identified from one site south of Tchibanga in southern Gabon. EACMV-UG was detected in samples collected from 12 sites, all from the eastern Provinces of Haute-Ogooue and Ogoou-Ivindo. Of the 17 samples infected with EACMV-UG, 16 were mixed infections with ACMV. Symptom severity of plants infected by EACMV-UG (4.1) was significantly greater (chi square = 44.4, df = 3, P < 0.001) than those infected by ACMV alone (2.8). Moreover, 4 of the 5 virus-sampled plants having current season whitefly-borne CMD were dual ACMV+EACMV-UG infections. These data comprise the first published record of CMGs in Gabon. The results also describe an early stage of spread of the EACMV-UG associated CMD pandemic into eastern Gabon, which now represents the pandemic's westernmost front. References Briddon RW, Markham PG, 1994. Universal primers for the PCR amplification of dicot-infecting geminiviruses. Molecular Biotechnology 1, 202-5. Dellaporta SL, Wood JJ, Hicks JB. 1983. A plant DNA minipreparation: version II. Plant Molecular Biology Reporter 1, 19-21. Neuenschwander P, Hughes J d'A, Ogbe F, Ngatse JM, Legg JP. 2002. The occurrence of the Uganda Variant of East African cassava mosaic virus (EACMV-Ug) in western Democratic Republic of Congo and the Congo Republic defines the westernmost extent of the CMD pandemic in East/Central Africa. Plant Pathology 51, 384. Zhou X, Liu Y, Calvert L, Munoz C, Otim-Nape GW, Robinson DJ, Harrison BD. 1997. Evidence that DNA-A of a geminivirus associated with severe cassava mosaic disease in Uganda has arisen by interspecific recombination. Journal of General Virology 78, 2101-2111. ------------------------------------------------------------------------ ProMED-mail [The occurrence of CMD in Gabon was not unexpected. ACMV, but not EACMV-UG, is present in the middle of the country, representing about half of the area of the country. Severe CMD (ACMV and EACMV-UG) is present in the southeast corner of Gabon. In east/central Gabon, ACMV predominates but EACMV-UG is frequently detected. It is interesting to note that mixed infections involving EACMV-UG and ACMV predominate, and this is associated with increased severity of CMD. Based on previous experience, the presumed direction of spread of the CMD pandemic associated with EACMV-UG is toward the northwest, in the direction of Equilateral Guinea. Effective disease management utilizes CMD-free planting stock and CMD-resistant cultivars. -Mod.DH] [see also: East African cassava mosaic Zanzibar virus - Kenya 20030408.0859 2002 ---- Cassava mosaic virus, Ugandan variant - Nigeria 20021207.6003 Cassava mosaic disease - East & Central Africa (02) 20020927.5416 Cassava mosaic disease - East & Central Africa 20020915.5321 2001 ---- Cassava diseases - Kenya 20011117.2829 East African cassava mosaic virus - West Africa 20010814.1920 East African cassava mosaic begomovirus 20010523.1003] .........................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Sun Nov 16 20:59:40 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Leaf rust, plum - Turkey Message-ID: <37oevbejbn.fsf@lios.aq2.gweep.ca> LEAF RUST, PLUM - TURKEY **************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 14 Nov 2003 From: ProMED-mail Source: British Soc. Plant Pathol., New Disease Reports Vol. 8[edited] First report of leaf rust on plum (_Prunus cerasifera_) by _Tranzschelia pruni-spinosa_ var. _discolor_ in the eastern Mediterranean region of Turkey S. Soylu , E.M. Soylu, and S. Kurt, Department of Plant Protection, University of Mustafa Kemal, Faculty of Agriculture, 31034 Hatay, Turkey. Accepted for publication 4 Nov 2003. During the 2003 growing season, plum producers in the eastern Mediterranean region of Turkey encountered defoliation of plum trees (_Prunus cerasifera_), as a result of rust infections. Disease was observed in almost all plum orchards in the region on leaves but not on fruit or twigs. Early disease symptoms were observed in late May as distinct angular bright-yellow lesions on the upper leaf surface. As the disease progressed, light orange-brown pustules (uredinia) bearing urediniospores were observed in the centre of the lesion on the lower leaf surface. By early September, leaf lesions turned dark brown as they produced teliospores within rusty brown pustules. Microscopic examination of pustules revealed clustered uredinio and teliospores. Single-celled urediniospores (23-42 x 13-20 micrometers) were broadly fusiform or clavate with a golden to cinnamon wall and markedly thickened at the apex (5-7 micrometers). Two-celled teliospores (25-39 x 18-25 micrometers) were chestnut to blackish in colour. The apical cell was darker, coarsely verrucose, globoid, and frequently showed wall thickening at the apex (3-5 micrometers). The basal cell was oblong or ovate, generally tapered towards the base, smaller and lighter than the apical cell. The causal agent was identified as _Tranzschelia pruni-spinosa_ (Pers.) Dietel var. _discolor_ (Fuckel) based on morphological characteristics (Laundon & Rainbow, 1971) and distinguished from _T. pruni-spinosa_ var. _pruni-spinosa_ on the basis of teliospore morphology and host range (domestic rather than wild plum). Pathogenicity tests were conducted on 1-year-old plum (cv. Canerigi) nursery stock grown in a greenhouse at 20 C. Plant leaves were inoculated by atomising an aqueous suspension of urediniospores (100 000 spores per ml) collected from diseased leaves. After inoculation, the plants were covered with a plastic bag for 48 h and kept in the growth room at 22 C with a 16 h photoperiod. Within 5 weeks after inoculation, typical uredinia and urediniospores developed on inoculated leaves. This is the first report of plum rust on cultivated plum in the eastern Mediterranean region of Turkey. Previous reports list _T. pruni-spinosae_ var. _discolor_ on cultivated plums in USA (Bolkan et al., 1985), India (Sharma & Bhardwaj, 2001) and Israel (Reuveni, 2000). References Bolkan HA, Ogawa JM, Michailides TJ, Kable PF, 1985. Physiological specialization in Tranzschelia discolor. Plant Disease 69, 485-6. Laundon GF, Rainbow AF, 1971. Tranzscheila pruni-spinosa var. discolor. C.M.I. Description of Pathogenic Fungi and Bacteria Set 29 No. 287. Kew, UK: Commonwealth Mycological Institute. Reuveni M, 2000. Efficacy of trifloxystrobin (Flint), a new strobilurin fungicide, in controlling powdery mildew on apple, mango and nectarine, and rust on prune trees. Crop Protection 19, 335-41. Sharma IM, Bhardwaj SS, 2001. Evaluation of plum cultivars and fungicides against rust. Plant Disease Research 16,100-3. ------------------------------------------------------------------------ ProMED-mail [_Prunus cerasifera_ (Cherry plum; Myrobalan plum) produces abundant edible fruits. _Tranzschelia discolor_ (Td), formerly _T. pruni-spinosae_ var. discolor, causes economic losses in stone fruits (peach, nectarine, apricot, plum, and wild _Prunus_ spp.) in regions with severe winters. Losses are potentially severe in orchards where orchards and nurseries are not sprayed regularly. Td is a cosmopolitan fungus, whereas _T. pruni-spinosae is found in Europe and USA. In California, the disease is common on foliage of prune but rarely infects prune fruit. The fungus that attacks the foliage of prunes, but rarely prune fruit. Rust occurs most frequently in Sacramento Valley orchards because it is favored by wet conditions. Severe foliar rust can cause defoliation, which may reduce yields if defoliation occurs well before harvest. Disease management depends upon applications of fungicides or sulfur. Additional reference: - Mod.DH] .......................................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Sun Nov 16 21:00:07 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Maize rough dwarf virus, maize - Greece: 1st report Message-ID: <37k75zejax.fsf@lios.aq2.gweep.ca> MAIZE ROUGH DWARF VIRUS, MAIZE - GREECE: 1ST REPORT ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 15 Nov 2003 From: ProMED-mail Source: British Soc. Plant Pathol., New Disease Reports, Vol. 8 [edited] C. I. Dovas, K. Eythymiou and N. I. Katis , Aristotle University of Thessaloniki, Faculty of Agriculture, Plant Pathology Laboratory, 54 124 Thessaloniki, Greece. Accepted for publication 27/10/03 In summer 2002, maize (_Zea mays_ L.) crops in northern Greece (Macedonia), showed severe dwarfing, reduced corn cob size and in some cases leaf reddening. These symptoms were different from those caused by Maize dwarf mosaic virus, which is endemic in maize crops in Macedonia. The dwarfing disease was only epidemic in 2002 and in some maize growing regions (Imathia and Serres), where crop losses were estimated to be over 70 percent. In contrast, in 2003 only a few cases were recorded. Symptoms were similar to those caused by 2 closely related members of the genus Fijivirus, Maize rough dwarf virus (MRDV), and Rice black-streaked dwarf virus (RBSDV) (Azuhata et al., 1993). The putative virus could not be transmitted mechanically from maize to maize or to other indicator plants. An RT-PCR was developed and optimised for the detection of both MRDV and RBSDV. 2 primers ('MRDV-F1': 5'-AGCGGAGAACGTTtggatc-3' and 'MRDV-R2': 5' -ttaacaacagcagcttcacc-3') were designed from highly conserved regions within both viral genomes (segment 8 from MRDV and 9 from RBSDV). Total RNA was extracted, denatured at 95 C in the presence of 1 micromole of primer 'MRDV-R2' and 10 percent DMSO, before being used as template for RT. RT and subsequent PCR were performed according to standard protocols (Dovas et al., 2001) with an annealing temperature of 60 C used in PCR. RT-PCR using total RNA from 15 plants showing typical dwarfing symptoms gave the expected 568 bp product, which was subsequently cloned and sequenced. Sequence comparisons revealed 96 percent identity with genome segment 8 of an Italian isolate of MRDV (L76561) (Marzachi et al., 1996), whereas identity with genome segment 9 of two RBSDV isolates from China (AF459812, AY050486) was 85 percent (Bai et al., 2002). The presence of MRDV was further confirmed by ELISA using polyclonal antibodies (BioRad Phyto-Diagnostics, France). More than 50 samples collected from Imathia and Serres area, showing MRDV symptoms tested positive by ELISA. This is the first report of MRDV in Greece. References Azuhata F, Uyeda I, Kimura I, Shikata E, 1993. Close similarity between genome structures of rice black-streaked dwarf and maize rough dwarf viruses. Journal of General Virology 74, 1227-1232. Bai FW, Yan J, Qu ZC, Zhang HW, Xu J, Ye MM, Shen DL, 2002. Phylogenetic analysis reveals that a dwarfing disease on different cereal crops in China is due to Rice black streaked dwarf virus (RBSDV). Virus Genes 25, 201-206. Dovas CI, Hatziloukas E, Salomon R, Barg E, Shiboleth Y, Katis N, 2001. Comparison of methods for virus detection in Allium spp. Journal of Phytopathology 149, 731-737. Marzachi C, Antoniazzi S, Aquilio M, Boccardo G, 1996. The double-stranded RNA genome of maize rough dwarf Fijivirus contains both mono and dicistronic segments. European Journal of Plant Pathology 102, 601-605. ------------------------------------------------------------------------ ProMED-mail [MRDV was first reported in _Zea mays_ from Israel in 1959. It is spreading in Argentina, the former Czechoslovakia, France, Israel, Italy, Norway, Spain, Sweden, and the former Yugoslavia. Susceptible hosts include oat (_Avena sativa_), barley (_Hordeum vulgare_) and several grasses. The virus is transmitted by several leafhoppers including _Delphacodes propinqua_, _Dicranotropis hamata_, _Laodelphax triatellus_ and others in the family _Delphacidae_. Maize seedlings infected at early stages produce almost no seeds. MRDV is related to several other fijiviruses (Rice black-streaked dwarf [RBSDV], Pangola stunt [PaSV], Mal de Rio Cuarto [MRCV]), although MRCV has been suggested as a distinct virus species. RBSDV commonly infects maize in China. A virus considered to similar to MCRV was reported from maize in India in 2001, but I don't know whether that report has been confirmed. Can any of our Indian colleagues provide information on this point? -Mod.DH] [see also: 2001 ---- Reovirus, maize - India (Andhra Pradesh) 20010309.0488] ......................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Sun Nov 16 21:01:08 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Bacterial ring rot, potato - UK (Wales): 1st report Message-ID: <37fzgnej98.fsf@lios.aq2.gweep.ca> BACTERIAL RING ROT, POTATO - UK (WALES): 1ST REPORT ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 13 Nov 2003 From: ProMED-mail Source: BBC News Online, 13 Nov 2003 Potato disease - more farms suspected ---------------------------------------------- 3 more potato farms in the UK are under restriction after the world's most damaging potato disease was found on a mid Wales farm. The disease -- bacterial ring rot -- has never before been found in the UK. The source is at Middlewood Farm in Bwlch, near Brecon. The disease can be described as the potato equivalent of the epidemic foot-and-mouth disease of 2001. The discovery of the disease was confirmed during an annual survey for ring rot by the UK Department for Environment Food and Rural Affairs (Defra), and it is thought the disease was brought into Wales on infected Dutch seed. The additional farms now under restriction -- 1 in Wales and 2 in the Scilly Isles -- had all taken delivery of seed potatoes from the Middlewood Farm over the last few weeks. Defra officials believe the outbreak is under control, and that it will be contained and eradicated. Experts are also talking to Spanish authorities about 2 consignments exported to the Canary Islands Although ring rot poses no risk to human health, farmers leaders in Wales had said the news is a "massive blow" to the industry. By comparison, annual losses to US potato farmers caused by ring rot have been as high as 50 percent. Farmers are also worried about the effect on the seed market if the UK loses its disease-free status. John Morgan, the farmer at the centre of this outbreak said: "Obviously we're devastated at the news. We're working with the Welsh assembly locally and Defra plant officials to eradicate this disease." Officers from Defra , the Welsh assembly, and the Plant Health and Seeds Inspectorate are meeting at the farm in the Brecon Beacons to assess the extent of the problem. It is likely crops will have to be burnt or buried. Meanwhile, experts are trying to trace any other movement of seed potatoes from the farm. It is known that the farm has exported to Spain and surrounding islands and supplies a vast area of Pembrokeshire, Wales' main potato production area. Countryside Minister Carwyn Jones has said he is following developments closely. "I can assure farmers that this is being taken extremely seriously by the Welsh Assembly Government and the other authorities concerned," he said. NFU Cymru's Malcolm Thomas said: "In terms of any wider spread, that would be extremely bad news for the industry, as this [bacterium] is the most potentially dangerous in the potato world." Brecon and Radnor MP Roger Williams agreed that the priority was the eradication of the disease. "I know the producers concerned have an excellent reputation for crop husbandry and health, and I am sure that this outbreak will not be traced to any negligence on their part." ------------------------------------------------------------------------ ProMED-mail [The disease is bacterial ring rot, caused by _Clavibacter michiganense_ subsp. _sepedonicus_ (Cms). Wales' potato industry is operated by 95 registered growers who farm 2000 hectares. Production amounts to 86 000 tonnes and is valued at 6.5 million BPS to the economy. Cms occurs throughout Europe, after being identified in recent years in France, the Netherlands, and Denmark. Defra officials consider it one of the most serious diseases of potato. Cms is spread by infected tubers, and a major concern for plant pathologists in Wales and other parts of the UK is the possibility that seed potato stocks could be infected. Sanitation is the key to disease management. Only classified seed should be used for planting; all machinery, equipment, vehicles, containers such as potato sacks, storage facilities such as bins, and any other possible source of the pathogen must be identified and rigorously cleaned and thoroughly disinfected. Finally, if possible, dispose of all potato waste at an approved tip (dump) or by incineration. Reference: - Mod.DH] [see also: Clavibacter sp., Ralstonia sp., potato - Germany 20030814.2020 2001 ---- Quarantine pests, potato, plum - Lithuania 20010604.1103 2002 ---- Bacterial wilt, potato - Canada (PEI) 20021215.6074 Clavibacter and Ralstonia spp., potato - Germany 20021016.5561 Bacterial pathogens, potato - Slovakia 20020724.4852 Bacterial wilt, ring rot, potato - Estonia 20020723.4841 Clavibacter, potato ring rot - Germany 20020120.3326 1999 ---- Clavibacter, potatoes - Lithuania 19990927.1731 Bacterial wilt, potato - Egypt: EU import ban 19990722.1236 Potato & tomato diseases - Europe 19990524.0863] .......................mpp/dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Nov 20 12:41:34 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Phakopsora pachyrhizi, soybean - Brazil Message-ID: <37smkiketu.fsf@lios.aq2.gweep.ca> PHAKOPSORA PACHYRHIZI, SOYBEAN - BRAZIL ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 18 Nov 2003 From: ProMED-mail Source: @gWorldwide, 18 Nov 2003 via Reuters [edited] Brazilian growers arm to fight Asian soy rust ------------------------------------------------ Soybean producers across Brazil have armed themselves this season in a battle against possibly the biggest threat to their livelihood -- a virulent strain of Asian soy rust caused by _Phakopsora pachyrhizi_. "The whole state is worried," said head agronomist Andre Neves Santos at the Moises Sachetti farms in Brazil's No. 1 soy state, Mato Grosso. "I've been to 5 training seminars on how to identify and combat rust fungus in the last few months." According to the U.S. Department of Agriculture, Brazil will become the world's No. 1 exporter of soy in 2003, displacing the USA. Experts agree that Brazil's future leadership in soy production will depend on how well it contains Asian rust, the most destructive soybean leaf disease, which reduces yields by up to 80 percent. Rust first showed up in Paraguay in 2001 and has since spread through Paraguay, Brazil, Bolivia, and parts of Argentina. U.S. producers are terrified at the possibility of the fungus reaching U.S. soy fields. Of the main soy states affected last season, Mato Grosso suffered the most because growers were caught off-guard, unconvinced it could travel so fast across Brazil's massive 20-million-hectare soy belt. "95 percent of producers in the state have already purchased all the fungicide they expect to need this season," said Cristina Santos, who added the cost of fungicide and its application would be expensive. Cost estimates of soy experts are around $50 per hectare. Rust showed up late in the growing cycle last season, reducing yield by 3 million tonnes off the 2002/03 crop, lowering Brazil's output to 52 million tonnes, said Jose Tadashi Yorinori, Brazil's top soy rust expert at the national plant research agency (Embrapa). As Brazil enters the peak of a new Sept-Dec planting season, Mato Grosso has already registered its first outbreaks of rust. "It began earlier this year," said Yorinori. He said losses were pronounced in Mato Grosso and Bahia last season because producers didn't identify the rust and spray soon enough. But this is also a particularly virulent strain of rust. Yorinori said tropical varieties of commercial soy seed that were previously thought to have some rust resistance last season did not have resistance to this virulent strain. Producers will have to rely largely on fungicide until new rust-resistant strains are developed -- but that is likely to take years. Embrapa has identified one soy variety (BR-134) that is resistant to rust, but it is not adapted to many growing regions in Brazil. Embrapa is working with private sector firms to find and develop more resistant soy varieties. For now, producers are betting on a tough spraying campaign to hold off the disease. [Byline:Reese Ewing] ------------------------------------------------------------------------ ProMED-mail [Soybean rust appeared in South America in 2001 and now occurs in Argentina, Brazil, and Paraguay. As of November 2002, USDA scientists had screened 1000 of 4000 public and commercial soybean lines against a mixed Pr population of 4 isolates from Zimbabwe, Thailand, Brazil, and Paraguay. Most were susceptible, but a few show a resistant reaction type or reduced numbers of lesions on infected leaves. Fungicides appear to be the only workable disease management strategy at present. Several efficacy trials are underway in Africa and South Africa to select candidate fungicides for rust control. Only 2 effective fungicides are currently registered for use in soybeans. In trials conducted outside the USA, 4 additional products have been identified as effective against Pr, but are not currently registered for use in soybeans. - Mod.DH] [see also: Soybean rust - Brazil 20030426.1022 Soybean rust - Zimbabwe (Arcturus) 20030222.0456 Soybean rust - Brazil (Sao Paulo State) 20030124.0214 Phakopsora sp., soybean, yield loss - Uganda 20030119.0176 Soybean rust - Brazil (Mato Grosso & Bahia) 20030415.0917 2002 ---- Phakopsora sp., soybean rust - S. Africa, Argentina 20021231.6167 Phakopsora sp., soybean rust - South Africa 20020206.3495 Phakopsora sp., rust, soybean - Zimbabwe 20020110.3220 2001 ---- Phakopsora sp., soybean rust - South Africa (03) 20011213.3014 Phakopsora sp., soybean rust - South Africa (02) 20010405.0679 Phakopsora sp., soybean rust - S. Africa (confirmed) 20010322.0569 Phakopsora sp., soybean rust - South Africa 20010312.0505 Phakopsora sp., soybean rust - Africa (02) 20010310.0491 Phakopsora sp., soybean rust - Nigeria 20010309.0486 Phakopsora sp., soybean rust - Africa 20010309.0487] ......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Nov 20 17:19:42 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Clavibacter, potato - UK (England) (02) Message-ID: <373ccik1ya.fsf@lios.aq2.gweep.ca> CLAVIBACTER, POTATO - UK (ENGLAND) (02) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 19 Nov 2003 From: ProMED-mail Source: @gWorldwide, 19 Nov 2003 via Reuters [edited] UK widens controls to keep out potato disease ----------------------------------------------- Britain's farm ministry on Wednesday said it was widening controls aimed at preventing an outbreak of a potentially devastating potato disease. The Department for Environment, Food and Rural Affairs (DEFRA) stated that it was extending precautionary action against potato ring rot to 3 new farms known to have received seed potatoes of the same variety as those found to be infected on a Welsh farm last week. 3 farms based in the southwest of England were already subject to restrictions after being supplied with seed potatoes from the infected Welsh farm. A DEFRA spokeswoman said one of the 3 new farms facing checks was in the north of England, while the others were in the south. "This new information merely means that we get the opportunity to make checks -- it does not mean that the disease has spread," the DEFRA spokeswoman said. The bacterial pathogen, _Clavibacter michiganensis_ subsp. _sepedonicus_, is widespread across Europe, having been identified in recent years in France, the Netherlands, and Denmark. The disease affects only potato yields and has no impact on human health. British growers produced 5.8 million tonnes of potatoes in 2003, a 13 percent drop from the previous year, according to recent British Potato Council data. ------------------------------------------------------------------------ ProMED-mail [Ring rot is an insidious disease and very difficult to manage. The fact that it has been reported from Wales and from 2 widely separated loci in England suggests that there are more cases in the offing. There appear to be at least 2 sources of infected potatoes, because the potatoes in England did not originate from the Dutch farm that supplied tubers to the grower in Wales. - Mod.DH] [see also: Clavibacter, potato - UK (Wales): 1st report 20031116.2843 Clavibacter sp., Ralstonia sp., potato - Germany 20030814.2020 2002 ---- Bacterial wilt, potato - Canada (PEI) 20021215.6074 Clavibacter and Ralstonia spp., potato - Germany 20021016.5561 Bacterial wilt, ring rot, potato - Estonia 20020723.4841 Clavibacter sp., potato ring rot - Sweden 20020419.3986 Clavibacter, potato ring rot - Germany 20020120.3326 Clavibacter, potato, imported - Cyprus ex Germany 20020116.3276 2001 ---- Clavibacter & ralstonia species, potato - Estonia 20011124.2882 Clavibacter sp., first report, potato - Austria 20011020.2584 Clavibacter sp., first report, potato - Austria 20011020.2584 Clavibacter sp., potato - Finland 20010606.1112 1999 ---- Clavibacter, potatoes - Germany 19991003.1777 Clavibacter, potatoes - Lithuania 19990927.1731] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Fri Nov 21 11:39:45 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Banana streak disease, antiviral therapy - Belgium Message-ID: <37oev5efbi.fsf@lios.aq2.gweep.ca> BANANA STREAK DISEASE, ANTIVIRAL THERAPY - BELGIUM ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 20 Nov 2003 From: ProMED-mail Source: Press Release, 1 Sep 2003, International Plant Genetic Resources Institute, Rome [edited] Human drugs cure banana disease ---------------------------------------- Drugs developed to treat human diseases such as hepatitis and AIDS can also be used to treat banana diseases, according to a study supported by the government of Belgium and published in the latest issue of the journal Antiviral Research. "This is very significant," said Dr Emil Frison, Director-General of the International Plant Genetic Resources Institute (IPGRI) and an author of the paper, "because it means we can now make full use of the diversity of bananas to create and distribute improved varieties." 400 million people in developing countries depend on bananas and plantains as a staple food. Plant breeders need access to as much diversity as possible in order to develop higher-yielding varieties with resistance to pests and diseases. For bananas, the world's biggest collection is maintained in trust for humanity at the Katholieke Universiteit in Leuven, Belgium. KUL sends plants to researchers worldwide through IPGRI's International Network for the Improvement of Banana and Plantain (INIBAP). International guidelines, however, allow only movement of disease-free plants, but a substantial part of the collection has been blocked because it is infected with banana streak virus (BSV). Researchers from KUL and the Gembloux Faculty of Agriculture have already developed several techniques for eliminating viruses from sterile cultures in the banana collection. These techniques are effective against other diseases, but BSV remained a problem. Knowing that BSV is quite closely related to hepatitis B virus, and uses some of the same chemical processes, the banana scientists got together with the Rega Institute for Medical Research at KUL. This institute was responsible for developing adefovir and tenofovir, antiviral compounds tested and approved for the treatment of hepatatis B and AIDS. The researchers grew infected banana cells in the presence of small doses of the drugs for 6 months. Testing of whole plantlets produced from those cells demonstrated that up to 90 percent of the plantlets showed no sign of BSV. Work is now proceeding to remove BSV from all samples in the collection at KUL. "The production of virus-free stocks is a very important control measure," said Dr Frison. "Not only does it mean the diversity collection is healthier, it also enables us to distribute newly bred varieties to [those] who need them." The technique may also be useful in the treatment of other viral diseases of economically important plants. Reference: Helliot B., Panis B., Frison E., De Clercq E., Swennen R., Lepoivre P., Neyts J., The acyclic nucleoside phosphonate analogues, adefovir, tenofovir and PMEDAP, efficiently eliminate banana streak virus from banana (Musa spp.). Antiviral Res. 59 (2003): 121-126. ------------------------------------------------------------------------ ProMED-mail [Banana streak disease was first described in Morocco and the causal virus, Banana streak badnavirus, was described in 1986. BSV has subsequently been recorded in Africa, Europe (Canary Islands and Madeira), Asia, North America (Florida), Central and South America, and the Pacific Islands. Infection of _Musa_ by BSV limits development of new _Musa_ hybrids in breeding programs worldwide. BSV has been transmitted experimentally by mealybugs (_Planococcus citri_ and _Saccharicoccus sacchari_) [Ss] both of which colonize banana. Results of surveys in Uganda show that _Dysmicoccus brevipes_ [Db] and Ss were the most prevalent mealybugs, and the incidence of banana streak was correlated with the presence of Db. Disease management is complicated because infected plants may be symptomless; but use of PCR and ISEM has facilitated rapid detection of BSV. - Mod.DH] [see also: 2001 ---- Citrus mosaic badnavirus: genome sequenced 20010607.1121] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Nov 26 11:42:19 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Viroids, peach - Czech Republic: 1st report Message-ID: <37ptff2cqc.fsf@lios.aq2.gweep.ca> VIROIDS, PEACH - CZECH REPUBLIC: FIRST REPORT ********************************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 25 Nov 2003 From: ProMED-mail American Phytopathological Society, Plant Disease Notes [edited] 1st Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic. M. Hassan and P. Rysanek, Department of Plant Protection, Czech University of Agriculture, Prague, Czech Republic; and F. Di Serio, Institute of Plant Virology, CNR, Bari, Italy. This work was supported from the grant QC1359 of the Ministry of Agriculture of the Czech Republic. Plant Dis. 87:1537, 2003; published on-line as D-2003-1002-01N, 2003. Accepted for publication 12 Sep 2003. Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, _Prunus davidiana_, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using 2 sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTACTACGGCGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1:CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The 2 pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species _P. davidiana_. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001. ------------------------------------------------------------------------ ProMED-mail [Viroids are extremely infectious pathogens. These circular, single-stranded covalent circles share extensive intramolecular base pairing, which confers resistance to nucleases in plant tissues. PLMVd is transmitted by grafting and by aphids (_Myzus persicae_) but not by mites or pollen. HSVd causes a severe disease in hop (_Humulus lupulus_), and strains of the viroid have been recognized in cucumber, grapevine, citron, peach, and plum. Both viroids are also easily transmitted by grafting or by use of contaminated pruning tools, but evidence of their transmission by vectors is apparently lacking for HSVd. Viroid disease management depends upon sanitation; plant viroid-free trees, sterilize shears after pruning each tree, and eradicate infected trees. References: - Mod.DH] [see also: 2002 ---- Peach latent mosaic viroid - Uruguay: first report 20021129.5931 Hop stunt and Peach latent mosaic viroids, peach - Italy 20020305.3688] .......................................dh/pg/lm *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Fri Nov 28 14:46:45 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> Erwinia sp., lentil, chickpea - Canada (SK) Message-ID: <377k1kp3nf.fsf@lios.aq2.gweep.ca> ERWINIA SP., LENTIL, CHICKPEA - CANADA (SASKATCHEWAN) ***************************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 27 Nov 2003 From: ProMED-mail Source: American Phytopathological Society, Plant Disease Notes [edited] 1st Report of Pink Seed of Lentil and Chickpea Caused by _Erwinia rhapontici_ in Canada. H. C. Huang, R. S. Erickson, and L. J. Yanke, Agriculture and Agri-Food Canada Research Centre, P.O. Box 3000, Lethbridge, AB, T1J 4B1, Canada; T. F. Hsieh, Department of Plant Pathology, Taiwan Agricultural Research Institute, Wufeng 413, Taichung, Taiwan; and R. A. A. Morrall, Department of Biology, University of Saskatchewan, Saskatoon, SK, S7N 5E2, Canada. LRC Contribution No. 38703047. Plant Dis. 87:1398, 2003; published on-line as D-2003-0911-01N, 2003. Accepted for publication 15 Aug 2003. A new disease of lentil (_Lens culinaris_ Medik.) and chickpea (_Cicer arietinum_ L.) caused by _Erwinia rhapontici_ (Millard) Burkh. was found in seed samples from commercial fields in Saskatchewan, Canada in 2002. Infected seeds had a pink or pinkish-brown discoloration of the seed coat. Isolation from surface-sterilized pink seeds resulted in bacterial cultures that produced a water-soluble pink pigment on potato dextrose agar (PDA). Four isolates from different lentil crops, LRC 8265, LRC 8310, LRC 8309, and LRC 8313 and one isolate from a chickpea crop, LRC 8266, were tested as previously described (2). Results of the tests were identical to those for pink bean isolates of _E. rhapontici_ (2) with the following minor exceptions: all were negative for Voges-Proskauer; LRC 8266 was positive for tagatose; LRC 8266, LRC 8309, and LRC 8313 were negative for lactose; and LRC 8266 and LRC 8309 were positive for 5-keto gluconate. For pathogenicity tests, each isolate was inoculated into 30 pods from 6 lentil plants (cv. Laird), 30 pods from 6 desi chickpea plants (cv. Myles), and 30 pods from 6 kabuli chickpea plants (cv. Sanford) by the method described for pink seed of pea (1) and bean (2). Each pod was inoculated with 0.1 ml (0.2 ml for kabuli chickpeas) of bacterial suspension, approximately 100 million CFU/ml, by injection through the mid-rib at the basal end. The same number of uninoculated and water-inoculated pods served as controls. Plants were kept in the greenhouse (20 +/- 5 deg C) for 4 weeks, after which isolations of the pathogen were performed as described above. In duplicate experiments, all the isolates caused pink lesions on pods and seeds of lentil, desi chickpea, and kabuli chickpea. The frequency of infected seeds among the 5 isolates (4 lentil and one chickpea) ranged from 50 to 100 percent on lentil, 73 to 100 percent on desi chickpea, and 43 to 100 percent on kabuli chickpea. _E. rhapontici_ was reisolated from seeds with lesions but not from asymptomatic seeds. The study demonstrates that in addition to pea (1) and common bean (2), _E. rhapontici_ is also the causal agent of pink seed of lentil and chickpea. The observation that lentil isolates can infect chickpea and vice versa suggests that host specificity may be lacking in _E. rhapontici_. To our knowledge, this is the first record of _E. rhapontici_ on lentil and chickpea. References: (1) H. C. Huang et al. Can. J. Plant Pathol. 12:445, 1990. (2) H. C. Huang et al. Plant Dis. 86:921, 2002. ------------------------------------------------------------------------ ProMED-mail [Infection of pulse crop seeds such as lentil and chickpea by _Erwinia rhapontici_ (Er) is reported to cause reduced germination and stunting of seedlings. Concern has been expressed by plant pathologists regarding spread of Er to pulse crops in western Canada. Plants are most susceptible to Er infection at the young pod stage. Er overwintered well in experiments conducted in western Canada. Viable Er cells were found in 47 percent of seeds and in 59 percent of stems left on the soil surface during the winter of 2000-2001, and survival percentage increased markedly in seed buried at a depth of 6 cm. The fungus is an opportunistic pathogen, reported also on bread wheat, durum wheat, and onion. Use of disease-free seed is the best method of disease management. Additional reference: - Mod.DH] [see also: 2002 ---- Pink seed disease, bean - Canada (Alberta) 20020816.5067 Erwinia rhapontici, pink seed disease, pea - USA (WA) 20020211.3535] .......................................dh/pg/lm *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Sat Nov 29 22:23:35 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:59 2005 Subject: PRO/PL> White leaf spot, dry bean - North America: 1st report Message-ID: <37k75il99k.fsf@lios.aq2.gweep.ca> WHITE LEAF SPOT, DRY BEAN - NORTH AMERICA: FIRST REPORT ******************************************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 28 Nov 2003 From: ProMED-mail Source: American Phytopathological Society, Plant Disease Notes [edited] First Report of White Leaf Spot of Dry Bean Caused by _Pseudocercosporella albida_ in North America. L. E. del Rao, C. A. Bradley, and R. S. Lamppa. Department of Plant Pathology, North Dakota State University, Fargo 58105. Plant Dis. 87:1537, 2003; published on-line as D-2003-1003-01N, 2003. Accepted for publication 23 Sep 2003. In August 2002, white leaf spot disease was observed on red kidney bean (_Phaseolus vulgaris_ L.) at 3 fields near Staples, MN. Disease incidence in these fields, calculated as the proportion of plants showing visible symptoms, ranged from 20 to 100 percent. Symptoms and signs consisted of abundant, white sporulation on the abaxial side of leaves that was limited by secondary veins, resulting in angular-shaped lesions. Corresponding with fungal growth, yellow, angular spots were observed on the upper leaf surface. In older leaves, lesions coalesced, covering most of their surface, while younger leaves were relatively free of symptoms. Heavily diseased plants senesced faster and defoliated earlier than nonsymptomatic plants. Identification of the pathogen was conducted by direct observation of infected plant tissues with light andelectron microscopes. Conidia were hyaline, filiform, rounded at their apex, and with no visible scar at their point of attachment to the conidiophore. Conidia had one to 4 septa, were 57 to 68 micrometers long, and approximately 2.4 micrometers in diameter. Conidia were produced at the tip of colorless, short conidiophores that emerged through stomata in groups of 5 or more. These traits are in agreement with the description of _Pseudocercosporella albida_ (Matta & Belliard) Deighton (1,2). A sample of infected tissues has been deposited at the U.S. National Fungus Collection (BPI 842303) at Beltsville, MD. The impact of this disease on bean yields in Minnesota was not estimated. However, in the cool highlands of Colombia, where white leaf spot is endemic, yields can be reduced by as much as 47 percent (3). To our knowledge, this is the first report of the presence of this pathogen on dry bean in North America. ------------------------------------------------------------------------ ProMED-mail [I could not find any information on white spot disease of dry bean caused by this fungus. Perhaps some of our readers can contribute relevant information. - Mod.DH] .......................................dh/pg/lm *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ * * * Please support the 2003 ProMED-mail Internet-a-thon! * * http://www.isid.org/netathon2003.shtml * * * ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-promed@promedmail.org. ############################################################ ############################################################