From brian at gweep.ca Wed Jul 2 14:57:37 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:54 2005 Subject: PRO/PL> Alternaria brown spot, citrus - (Brazil & Argentina) Message-ID: <37brwcve7y.fsf@lios.aq2.gweep.ca> ALTERNARIA BROWN SPOT, CITRUS (BRAZIL & ARGENTINA) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases http://www.isid.org Date: 29 June 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] Outbreaks of Alternaria Brown Spot of Citrus in Brazil and Argentina. N. A. R. Peres, Instituto Biol?gico, S?o Paulo, SP, Brazil; J. P. Agostini, INTA, Montecarlo, Misiones, Argentina; and L. W. Timmer, University of Florida, CREC, Lake Alfred. Plant Dis. 87:750, 2003; published on-line as D-2003-0407-01N, 2003. Accepted for publication 20 March 2003. _Alternaria alternata_ (Fr.) Keissler causes lesions on leaves, twigs, and fruit and reduces yield and fruit quality of many tangerines (_Citrus reticulata_) and their hybrids (2). Severe outbreaks of Alternaria brown spot were observed on 'Murcott' tangor (Citrus reticulata ? Citrus sinensis) trees in southern S?o Paulo, southern Minas Gerais states in Brazil, and in Misiones and Corrientes provinces in Argentina. A single diseased 'Fortune' tangerine tree was observed in a grove in Misiones. On young leaves, brown-to-black lesions often expanded to cover large parts of the leaf, causing abscission of young shoots and dieback of twigs. Lesions were often surrounded by yellow halos. On fruit, darkspecks from 0.2 to 0.5 cm were observed, and severe infection caused premature fruit abscission. Isolations were made on potato dextrose agar (PDA) after surface sterilization of leaf and fruit tissues in 1.5 percent sodium hypochlorite for 1 min. Plates were incubated at 27 C in the dark for 1 week. Isolated colonies were olive brown to black, and the fungus was stimulated to form conidia by scraping the surface of the mycelium. The pathogen was a typical small-spored _Alternaria_ species, and the morphological characteristics of the conidia and conidiophores fit the description of _A. alternata_. Inoculation of 3 detached young shoots of 'Murcott' with a conidial suspension (100 000 conidia per ml) confirmed pathogenicity of 3 isolates obtained from widely separated groves in southern and eastern S?o Paulo State in Brazil and one from Misiones Province in Argentina. A control treatment with an equal number of shoots was sprayed with distilled water only. After 48 h, all isolates caused dark lesions on the leaves, characteristic of the disease. Symptoms were observed on inoculated, but not on control shoots. Koch's postulates were satisfied by reisolation of the fungus from symptomatic tissue in all cases. Although Alternaria brown spot was reported previously in neighboring Rio de Janeiro, Brazil on 'Dancy' and 'Ponkan' tangerines (1), serious disease problems now occur on 'Murcott', an important commercial variety in the major production area in Brazil. To our knowledge, this is the first report of Alternaria brown spot in Argentina. References: (1) A. de Goes et al. Fitopatologia Brasileira 26(Suppl.):386, 2001. (2) L. W. Timmer et al. Pages 19-21 in: Compendium of Citrus Diseases. 2nd ed. L. W. Timmer, S. M. Garnsey, and J. H. Graham, eds. The American Phytopathological Society, St. Paul, MN, 2000. - Mod.DH] -- ProMED-mail promed@promedmail.org [Alternaria brown spot, caused by _Alternaria alternata_ pv. _citri_, affects Minneola tangelos, Dancy tangerines, Murcotts, and less frequently Orlando tangelos, Novas, Lees, and Sunburst. In rare cases, it may also infect grapefruit. Under severe disease conditions, the disease results in extensive fruit drop and must be controlled on processing and fresh market fruit. Copper-containing fungicides are effective for that purpose, but development of copper-resistant strains through exposure to high concentrations of fungicide may be a concern. -Mod.DH] [see also: Citrus sudden death, oranges - Brazil (02) 20030322.0708 2001 ----- Alternaria brown spot, citrus - Spain 20010606.1114 2000 ----- Alternaria of citrus: new taxonomy 20000525.0834 1999 ----- Fungal brown spot of citrus, new? - Israel, Turkey (02) 19990930.1752 Fungal brown spot of citrus, new? - Israel, Turkey 19990925.1718 EPPO alert list: August 1999 19990925.1704 EPPO alert list, part 1/5: August 1999 19991027.1947] ........................dh/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Jul 2 14:58:19 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Fusarium bulb rot, onion - USA (WA) Message-ID: <377k70ve6t.fsf@lios.aq2.gweep.ca> FUSARIUM BULB ROT, ONION - USA (WASHINGTON) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases http://www.isid.org Date: 29 June 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] _Fusarium proliferatum_ Pathogenic on Onion Bulbs in Washington. L. J. du Toit and D. A. Inglis, Washington State University-Mount Vernon REU, 16650 State Route 536, Mount Vernon 98273; and G. Q. Pelter, Washington State University-Grant Adams Extension Office, P.O. Box 37, 1st and C Street, Ephrata 98823. Plant Dis. 87:750, 2003; published on-line as D-2003-0409-01N, 2003. Accepted for publication 31 March 2003. Isolations from the discolored areas of the dry scales onto water agar and PDA yielded fungal colonies characteristic of _F. proliferatum_ [Fp] (3). The isol_Fusarium oxysporum_ f. sp. _cepae_ and an unidentified _Fusarium_ species have been reported to cause bulb rot of onion (_Allium cepa_ L.) in Washington (1). In August and September 2002, a salmon-pink discoloration was observed on the outer 3 to 4 layers of dry scales of approximately 20 percent of white onion bulbs of cv. Cometa F1, in each of two 20-acre fields in the Columbia Basin of central Washington. Isolations from the discolored areas of the dry scales onto water agar and PDA yielded fungal colonies characteristic of Fp. The isolates formed long, V-shaped chains of microconidia on polyphialides. Pathogenicity of the isolates of Fp was tested on white onion bulbs purchased at a local grocery store. The outermost dry scales of each bulb were removed, and the bulb was inoculated by 1 of 3 methods: (i) a 5 cubic mm section of the fleshy scales was removed using a scalpel, the wound was filled with a 3 square mm plug of PDA colonized by Fp, the plug was covered with the section of scale that had been removed, and the inoculation site was covered with Parafilm; (ii) the basal plate of the bulb was dipped into a suspension of 1 million microconidia per ml; or (iii) the basal plate was dipped into the spore suspension after wounding by inserting a dissecting needle into the bulb to a depth of 1 cm. A noninoculated bulb provided a control treatment. Bulbs were incubated in a moist chamber at 13?C and examined for discoloration of the outer scales and development of bulb rot. After 2 weeks, salmon-pink discoloration of the outer scales was observed at the inoculation site for both methods of dip inoculation, but not for the plug inoculation method. After 3 weeks, water-soaked, tan to golden, shrunken, soft tissue was observed on the remainder of each dip-inoculated bulb, but symptoms of basal rot did not develop. Symptoms were similar to those reported in Idaho for a bulb rot of stored onions caused by Fp (2). One of the nonwounded inoculated bulbs did not develop a bulb rot, but pinkish discoloration was observed beneath the outer scales and in the neck. Fp was reisolated from the inoculated bulb tissues. The discoloration observed on the white onions raised concern about the potential for infection to develop into bulb rot in storage. However, thorough curing of the bulbs immediately upon storage restricted infection to the outer dry scales. Similar symptoms were observed at harvest on the bulbs of other white onions in a cultivar trial located near Quincy, WA, although symptoms were not observed on yellow or red cultivars in the trial. The same symptoms were later observed on approximately 70 percent of bulbs harvested from a 32-acre fresh-market crop of the cv. Sterling in the Columbia Basin. These symptomatic bulbs were rejected for the fresh market. To our knowledge, this is the first report of infection of onion bulbs by Fp in Washington, which in 2001, had the third largest acreage on onions in the United States after California and Oregon (USDA National Agricultural Statistics Service). References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) S. K. Mohan et al. (Abstr.) Phytopathology 87:S67, 1997. (3) P. E. Nelson et al. Fusarium species: An Illustrated Manual for Identification. The Pennsylvania State University Press, University Park, 1983. -- ProMED-mail promed@promedmail.org [This report documents spread of Fp to production fields in the state of Washington. Post-harvest bulb rot is a major constraint to production of onion. Proper storage and curing can reduce bulb rot incidence and maintain onion quality. - Mod.DH] .......................................dh/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jul 7 10:21:02 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Phaeomoniella decline, grapevine - USA (NY,PA) Message-ID: <37u19y9ukx.fsf@lios.aq2.gweep.ca> PHAEOMONIELLA DECLINE, GRAPEVINE - USA (NY,PA) ********************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 4 Jul 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] First Report of _Phaeomoniella chlamydospora_ on _Vitis vinifera_, _Vitis labrusca_, and French American Hybrids in Pennsylvania and New York. E. L. Stewart and N. G. Wenner, Department of Plant Pathology, The Pennsylvania State University, University Park 16802; and B. E. Hed, Lake Erie Research and Extension Center, North East, PA 16428. Plant Dis. 87:750, 2003; published on-line as D-2003-0404-01N, 2003. Accepted for publication 5 Mar 2003. _Phaeomoniella chlamydospora_ [Pc] (W. Gams, Crous, M.J. Wingfield. & L. Mugnai) Crous & Gams (= _Phaeoacremonium chlamydosporum_) was isolated during the growing seasons of 2001 and 2002 from roots, trunks, and cordons of grapevines including cultivars Concord, Niagara, Steuben, Catawba, Dutchess, DeChaunac, Vidal, Seyval, Chambourcin, Chardonnay, Riesling, Sangiovese, Dolcetto, Baco Noir, Merlot, Villard, Pinot Gris, GR7, and 3309C root stock representing 18 locations in Eastern, Central, and Lake Erie regions of Pennsylvania as well as the Lake Erie and Finger Lakes regions of New York. Pc was isolated from 89 percent of samples from vines 3 to 45 years old showing decline symptoms in the field. Isolates were identified based on a previous description (1) and by internal transcribed spacer (ITS1-5.8S- ITS2) rDNA sequences identical to those of Pc isolated from _Vitis vinifera_ from Italy (ex-type culture CBS229.95, GenBankAccession No. AF197973). Pc is firmly established as a member of the petri and esca disease complex and as a pathogen of grapevines (2,3). To test pathogenicity of our isolates, approximately 30 microliters of a suspension of 1 million conidia/ml, obtained from 6 isolates, was injected into the pith of 60 single-node, dormant, unrooted cuttings of '3309C' and 'Concord'. 10 control cuttings of 'Concord' and '3309C' were injected with an equal volume of sterile distilled water. From 24 to 32 weeks after inoculations, all Pc-inoculated cuttings exhibited dark streaking of the vascular tissue extending 45 to 50 mm from the point of inoculation. The vascular streaking observed in inoculated plants was identical to symptoms observed in declining vines in the vineyard. Vascular streaking was absent in the controls. Pc was isolated as a monoculture from regions of vascular streaking in 89 percent of inoculated cuttings. Pc was not isolated from the water-treated controls. Pc is widespread and readily isolated from declining grapevines in Pennsylvania, New York, and other national and international grape growing regions. To our knowledge, this is the first report of Pc from the cultivars cited above in Pennsylvania and New York. References: (1) M. Groenewald et al. Mycol. Res. 105:651, 2001. (2) Phytopathol. Mediterr. 39(1), 2000. (3) Phytopathol. Mediterr. 40, Supplement 2001. -- ProMED-mail [Pc is a frequent pathogen of grapevine and is of considerable concern to growers in temperate areas of USA, France, Italy, New Zealand, and South Africa. Infected plants are frequently stunted with chlorotic, sparse, and stunted leaves and are poor producers of grapes. Several other fungi (another species of _Phaeomoniella_, 2 species of _Phaeoacremonium_, and _P. inflatipes_ and _P. aleophilum_, have been associated with young grapevine decline in major production regions of California. The disease caused by Pc is difficult to detect in its early stages, but a PCR technique has been developed. Disease management involves use of hot-water-treated planting material, avoidance of damage by mechanical equipment, pruning late in the season, and application of systemic fungicides. A useful reference: - Mod.DH] [see also: 1999 ---- Phaeoacremonium vine decline - USA (California) 19991024.1917] .......................................dh/pg/lm *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jul 7 10:21:44 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Potato mop-top virus, potato - USA (Maine) Message-ID: <37ptkm9ujr.fsf@lios.aq2.gweep.ca> POTATO MOP-TOP VIRUS, POTATO - USA (MAINE) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 6 July 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] First Report of Potato mop-top virus on Potato from the United States. D. H. Lambert, Department of Plant, Soil and Environmental Sciences, University of Maine, Orono 04469; L. Levy and V. A. Mavrodieva, APHIS-PPQ-CPHST, National Plant Germplasm and Biotechnology Laboratory, Beltsville, MD 20705; S. B. Johnson, University of Maine Cooperative Extension, Presque Isle 04769; and M. J. Babcock and M. E. Vayda, Department of Biochemistry, Microbiology and Molecular Biology, University of Maine, Orono 04469. Plant Dis. 87:872, 2003; published on-line as D-2003-0430-02N, 2003. Accepted for publication 15 Apr 2003. Potato mop-top virus (PMTV) is a tripartite pomovirus vectored by the powdery scab plasmodiophoromycete _Spongospora subterranea_ pv. _subterranea_ (1). PMTV occurs on potato (_Solanum tuberosum_) in Europe, the Andes, Asia, and Canada. Internal necrotic arc and fleck tuber symptoms ("spraing") may reduce commercial acceptance of some cultivars (3). PMTV symptoms were discovered in 'Shepody' tubers at the Aroostook Research Farm, Presque Isle, ME in May 2002 and subsequently in 'Russet Burbank' tubers in commercial storage from the 2001 Maine crop. Symptomatic tubers exhibited single or multiple concentric necrotic arcs that were partial or complete, but exhibited no distinct external symptoms. The presence of PMTV in eight 'Shepody' tubers was indicated by positive enzyme-linked immunosorbent assay (ELISA; Adgen, Ltd., Auchincruive, Ayr, Scotland) and confirmed by reverse-transcription polymerase chain reaction (RT-PCR). 'Russet Burbank' potatoes were visually diagnosed, and the corresponding halves of 128 symptomatic tubers were forwarded to the University of Maine and APHIS (Beltsville, MD). Of these, ELISA readings in Maine were strongly positive (>3 x background) for 88, ambiguous (1.5-3 x back-ground) for 13, and negative for 27. Subsamples from these three categories were positive by PCR in 17 of 17, 9 of 9, and 12 of 14 cases, respectively. A similar rating, positive or ambiguous, in ELISA testing was identical for all but one case at Beltsville. Confirmation of PMTV required PCR testing, resulting in a characteristic PCR product of 401 bp that was generated from the coat protein coding region on RNA 2 (2) using the primer pair PMTV 1 5'-GCAGCCGTCGAGAATAGATA-3' (RNA nucleotides 316-335) and PMTV 4 5'-GCGAGTTGATGTGCCACATT-3' (complementary to RNA 2 nucleotides 716-697). An immunocapture RT-PCR using this primer set and the coating antibody from the Adgen ELISA kit was also successful in detecting PMTV. In separate reactions, a second product of 646 bp was generated from the triple gene block on RNA 3 (4) using the primer pair PMTV 5 5'-GGTGAAGAGGACAAGGT-3' (RNA molecules 1417-1436) and PMTV 7 5'-AACAGTCCGGTCTTGTGAAC-3' (complementary to RNA 3 nucleotides 2063-2044). The sequence of these products was 98 to 100% identical to PMTV published sequences. The discovery of this virus will result in adjustments to U.S. and Canadian seed potato certification standards and symptom characterization for common North American cultivars. References: (1) R. A. C. Jones and B. D. Harrison. Ann. Appl. Biol 63:1, 1969. (2) S. Kashiwazak et al. Virology 206:701, 1995. (3) M. Sandgren et al. Am. J. Potato Res. 79:205, 2002. (4) K. P. Scott et al. J. Gen. Virol.75:3561, 1994. -- ProMED-mail [This is the first report of PMTV in Plant Disease, but it is not the first report of the disease in the USA. The first report was on 8 Aug 2002 followed by several others in the same year. PMTV was found earlier in 2003 in Nova Scotia. - Mod.DH] [see also: Potato mop-top virus, potato - Canada (Nova Scotia) 20030105.0038 2002 ---- Potato mop-top virus, potato, first report - USA (Maine) 20020810.5017 Potato mop-top virus, potato - USA (FL, ID & MD) 20020821.5106 Potato mop-top virus, potato - North America 20020928.5422 Potato mop-top virus, potato - Canada (P.E.I) 20021010.5510] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Tue Jul 8 08:53:54 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Grapevine leaf rust - Australia (Northern Territory)(02) Message-ID: <37wuet3w8t.fsf@lios.aq2.gweep.ca> GRAPEVINE LEAF RUST - AUSTRALIA (NORTHERN TERRITORY)(02) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 6 Jul 2003 From: ProMED-mail Source: Australian Broadcasting Corp., 30 Jun 2003 [edited] Disease threatens NT wine industry ----------------- The Northern Territory's (NT) fledgling wine industry has been set back by the news that half of the 400 grapevines in Darwin are infected with the exotic disease grapevine leaf rust [GLR] caused by _Phakopsora euvitis_. The discovery was made as part of a national program aimed at eradicating the disease from Australia. GLR, only found in the top end of NT so far, causes defoliation and poses a risk to the country's multi-billion dollar table grape and wine industries. Project director Steven West says there are plans to extend the program further south. "Katherine is currently outside of our existing quarantine area, but it's the next nearest major centre and we're considering doing that from the point of view of making sure that the disease hasn't moved," he said. -- ProMED-mail [In addition to Australia, GLR occurs in Asia, India, Indonesia, Japan, Korea, Democratic People's Republic of Korea, Myanmar, Philippines, Sri Lanka, Taiwan, Thailand, and possibly in the Russian Far East. The primary hosts are _Vitis labrusca_ and _V. vinifera_, but other species are also susceptible. Infection causes poor shoot growth and reduction in fruit quantity and quality. The taxonomy of species infecting grapevine in the Americas is not well defined and more research is required to define the pathogen. The decision to survey for GLR at Katherine, about 250 miles southeast of Darwin, makes sense. Disease management involves eradication of infected vines, monitoring to determine spread and application of fungicides. A useful reference site: - Mod.DH] [see also: Grapevine leaf rust - Australia (Northern Territory) 20030423.0993 2002 ---- Grapevine leaf rust - Australia (Northern Territory) 20021106.5729] ..............................mpp/dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Jul 9 09:18:45 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Tomato infectious chlorosis, tomato - Indonesia Message-ID: <377k6rzq23.fsf@lios.aq2.gweep.ca> TOMATO INFECTIOUS CHLOROSIS, TOMATO - INDONESIA ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 6 July 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] First Report of Tomato infectious chlorosis virus in Tomato in Indonesia. J. Th. J. Verhoeven, T. M. Willemen, and J. W. Roenhorst, Plant Protection Service, Section Virology, P.O. Box 9102, 6700 HC Wageningen, the Netherlands; and R. A. A. van der Vlugt, Plant Research International, P.O. Box 16, 6700 AA Wageningen, the Netherlands. Plant Dis.87:872, 2003; published on-line as D-2003-0506-02N, 2003. Accepted for publication 15 Apr 2003. In 2002, a breeding company submitted several samples of tomato (_Lycopersicon esculentum_) for diagnosis. Samples originated in Indonesia and were taken from protected and nonprotected crops. Plants exhibited severe chlorosis on fully expanded leaves, while young leaves were symptomless. Symptoms resembled those of the criniviruses Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV). Moreover, large numbers of whiteflies, potential vectors of these viruses, had been observed at the plots with symptomatic plants. A reverse transcription-polymerase chain reaction (RT-PCR) with specific primers for TICV (1) yielded amplicons of the expected size of approximately 500 bp for all samples. One of the amplicons was sequenced (Genbank Accession No. AY221097) and revealed more than 98.9 percent identity to 6 isolates of TICV in NCBI Genbank. cDNA synthesis using the universal crinivirus primer HSP_M2-DW (5'-TCRAARGTWCCKCCNCCRAA-3') followed by PCR with a ToCV specific primer set (ToCV-UP 5'-TCATTAAAACTCGGGACCGAG-3' and ToCV-DW 5'-GCGACGTAAATTGAAACCC-3') was negative in all cases. Grafting of symptomatic shoots onto healthy tomato seedlings of cv. Money-maker showed transmission of the virus, as chlorosis appeared on fully expanded leaves of lateral shoots after 6 weeks. The presence of TICV in the graft-inoculated plants was confirmed by RT-PCR. Furthermore, mechanical inoculation to a range of herbaceous test plants did not evoke any virus symptoms, indicating the absence of mechanically transmissible viruses. Although other nonmechanically transmissible viruses cannot be fully excluded, the results together with the symptoms observed, indicate that TICV is the cause of the disease. TICV has been reported from Greece, Italy, Japan, Spain, and the United States, but to our knowledge, this is the first report of TICV in Indonesia. Reference: (1) A. M. Vaira et al. Phytoparasitica 30:290, 2002. -- ProMED-mail [ToCV is transmitted by the greenhouse whitefly, _Trialeurodes vaporariorum_, and is a nasty pest, especially in glasshouse operations. Although it can cause severe crop losses in fresh market and glasshouse-produced tomatoes, damage is generally minor. It also infects several other food crops monitored by ProMED-Plant such as lettuce (_Lactuca sativa_) and potato (_Solanum tuberosum_). Disease management requires use of virus-free transplants, avoidance of susceptible hosts, especially weeds, roguing of infected plants, and control of insects by insecticides. - Mod.DH] [see also: 2002 ---- Tomato criniviruses, detection - Greece 20021130.5939 Tomato infectious chlorosis virus, tomato - Spain 20020706.4678 1998 ---- Tomato infectious chlorosis - USA/Italy 19980706.1264 1997 ---- Tomato infectious chlorosis virus - USA (California) 19970310.0535] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Jul 10 09:03:19 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Soybean cyst nematode - USA (Arkansas) Message-ID: <374r1uxw3s.fsf@lios.aq2.gweep.ca> SOYBEAN CYST NEMATODE - USA (ARKANSAS) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 8 Jul 2003 From: ProMED-mail Source: Farm Press (FP) Online, 3 Jul 2003 [edited] Cyst nematodes attacking Arkansas beans ----------------------------- The discovery of significant cyst nematode populations in central Arkansas has left producers and Extension personnel nervous and alert. Found in Prairie County around Des Arc and Hazen, nematodes have struck "sizable fields in a bad way," says agent Hank Cheney. He forecasts yield reductions from 10 to 40 percent, adding that it is either race 5 or race 6. According to Chris Tingle, Arkansas Extension soybean specialist, you could pull a plant and immediately see cysts all over the roots in very high numbers. Cliff Coker, Extension plant pathologist, points out that root systems are already injured and are now susceptible to soybean sudden death syndrome, charcoal rot, and other root pathogens. Tingle says that not much can be done. "Picking up symptoms, identifying fields, and getting a race analysis -- which is what I'm begging producers to do -- is about all that can be done. The race must be identified. It will cost a bit up front, but the investment can be recouped easily by being able to choose the proper resistant variety and avoiding yield losses in future years." Typically, nematode damage shows up at the end of July and into August. But producers began picking up symptoms last week when temperatures hit 95 degrees for the first time this year. Coker says that "the only thing that producers can do is to not stress their soybeans further. That's especially true of water stress. So if an infested field can be irrigated, the producer should be very quick to crank up the pumps." If the weather pattern the state is in continues, "producers should start looking for foliar diseases -- aerial blight, frogeye leaf spot -- at flowering. Another disease that we should be looking for is stem canker," he says. Coker says the biggest problem producers face is lack of varieties resistant to nematode races now found in Arkansas. "I think we've backed ourselves into a corner by pushing for yield and ignored pests that can rob yield," he says. "If you look at the majority of the varieties we recommend, they're resistant to Races 3 and 14," says Tingle. "We've done surveys in a number of counties to find out what races we have and 3 and 14 aren't the ones we have. We've got to work on our germ plasm because variety selection is our only defense against nematodes. This could easily become a statewide epidemic and we don't have a single tool to combat it." [Byline: David Bennett] -- ProMED-mail [_Heterodera glycines_ (the soybean cyst nematode [SCN]) causes one of the most important diseases of soybeans. Yield losses of up to 30 percent, mainly because fewer pods are produced on infected plants. Moreover, soybean yield is directly related to the numbers of nematodes feeding on soybean roots. SCN-infected soybean is also more susceptible to infection by brown stem rot of soybean, caused by the fungal pathogen _Phialophora gregata_, in both resistant and susceptible soybean cultivars. Unfortunately, SCN cannot be eliminated from affected fields. Disease management involves providing plants with adequate moisture and fertility; implementation of sensible sanitation practices to prevent movement of the nematode to SCN-free fields; thorough cleaning of equipment by high-pressure water or steam; utilization of resistant cultivars; planting non-hosts such as corn, oat, and alfalfa so as to reduce nematode populations; and application of nematicides, which offer temporary control. A useful reference: - Mod.DH] [see also: 2002 ---- Heterodera glycines, soybean - Europe: alert 20020802.4914] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Sun Jul 13 08:35:19 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Phytophthora capsici, tomato - Mexico (Michoacan) Message-ID: <37fzlao5p5.fsf@lios.aq2.gweep.ca> PHYTOPTHTHORA CAPSICI, TOMATO - MEXICO (MICHOACAN) ************************************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 10 Jul 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] Buckeye Rot of Tomato Caused by _Phytophthora capsici_ in Michoacan, Mexico. S. P. Fernandez-Pavia and G. Rodriguez-Alvarado, Instituto de Investigaciones Agropecuarias y Forestales, Universidad Michoacana de San Nicolas de Hidalgo, Morelia, Michoacan 58240, Mexico; and J. M. Sanchez-Yanez, Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana de San Nicolas de Hidalgo, Morelia, Michoacan 58030, Mexico. Plant Dis. 87:872, 2003; published on-line as D-2003-0506-01N, 2003. Accepted for publication 23 Apr 2003. The state of Michoacan is one of the main fresh pepper (_Capsicum annuum_ L.) and tomato (_Lycopersicon esculentum_ Mill.) producers in Mexico. During the last 5 years, pepper-producing areas in the state have become unproductive due to root-rotting pathogens, mainly _Phytophthora capsici_ Leonian. Growers trying to overcome losses have increased tomato production in areas previously used for pepper production. Field-grown tomato plants with diseased green tomato fruits were observed in Tacambaro, Michoacan, during August 2002. Initially, brown-to-black lesions developed on fruits in contact with soil, followed by infection of the upper fruits in the raceme. Lesions enlarged and dark zonate "buckeye" bands were formed in the affected area. Disease fruit turned mushy. Symptoms observed were similar to those for buckeye rot of tomato (1). Disease fruit were surface disinfested with 70 percent ethanol, cut into 0.5-cm slices, and incubated in a moist chamber to induce mycelial colonization. Isolation from mycelial tufts growing through the tomato slice was performed 3 days later, and mycelia was transferred to PARP selective medium (corn meal agar (CMA) plus ampicillin, pimaricin, rifampcin, and pentachloronitrobenzene). _P.capsici_ was consistently isolated from diseased tomato fruits. Oomycete identification was based on sporangial and gametangial characteristics of cultures grown on CMA (1). Sporangia microscopically observed were spherical, broadly ellipsoid, or obovoid with 1 papilla (occasionally 2 papillae), and deciduous with a long pedicel. Chlamydospores were not present (2). The isolates were heterothallic, and oogonia with amphigynous antheridia were observed in pairings with A1 and A2 isolates of _P. capsici_. 3 isolates were A1 and 2 isolates were A2. To confirm pathogenicity, 2 experiments were performed using 20 healthy unwounded green tomatoes. 1 isolate of each mating type was tested. Isolates were grown for 5 days on CMA, and fruits were inoculated by placing _P. capsici_ in contact with the fruit. Inoculated fruits were kept in a moist chamber at room temperature (17 to 20 deg C). Initial symptoms in the form of brown-to-black lesions appeared 24 h after inoculation. 1 week after inoculation, symptoms were similar to those observed in field-grown plants, and _P. capsici_ was recovered from the margins of the diseased tissue. All inoculated fruits rotted. To our knowledge, this is the first report of _P. capsici_ causing buckeye rot on tomato in Michoacan and of the presence of both mating types in the area. References: (1) D.C. Erwin and O.O. Ribeiro. _Phytophthora_ Diseases Worldwide. The American Phytopathological Society. St. Paul, MN. (2) M. Aragaki and J.Y. Uchida. Mycologia 93:137, 2001. -- ProMED-mail [In addition to _P. capsici_, 2 other _Phytophthora_ species (_P. parisitica_ and _P. drechsleri_) have been implicated in causing buckeye rot. Other crops affected by these species include beans, corn, eggplant, melons, onions, pepper, potato, pumpkin, rhubarb, squash, and turnip. Disease development is favored by warm, wet weather. Management of the disease depends on use of phytosanitary measures, preventing tomato fruits from contacting soil, crop rotation, and application of chemical fungicides. Apparently there are no tomato cultivars that are resistant to _P. capsici_. - Mod.DH] [see also: 2002 ---- Phytophthora capsici, cucurbits - Spain (Granada) 20020608.4440] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Sun Jul 13 08:35:42 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Cabbage leaf spot - USA (Florida) Message-ID: <37brvyo5oh.fsf@lios.aq2.gweep.ca> CABBAGE LEAF SPOT - USA (FLORIDA) ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 10 Jul 2003 From: ProMED-mail Source: Amer Phytopathol Soc, Disease Notes [edited] An Outbreak of a Leaf Spot Disease of Cabbage in Southern Florida Caused by _Xanthomonas campestris_ pv. _armoraciae_. K. Pernezny, University of Florida, Everglades Research and Education Center, 3200 E. Palm Beach Rd, Belle Glade 33430; J. B. Jones, University of Florida, Department of Plant Pathology, 1453 Fifield Hall, Gainesville 32611; P. D. Roberts, University of Florida, SW Florida Research and Education Center, 2686 SR 29 N, Immokalee 34142; and E. Dickstein, University of Florida, Department of Plant Pathology, 1453 Fifield Hall, Gainesville 32611. Florida Agric. Exp. Sta. Journal Series R-09462; Plant Dis. 87:873, 2003; published on-line as D-2003-0501-02N, 2003. Accepted for publication 16 Apr 2003. From October to December 2001, a leaf spot disease was observed in numerous commercial fields of red and green cabbage (_Brassica oleracea_ var. _capitata_ L.) in the Everglades Agricultural Area, south and east of Lake Okeechobee and in the environs of Immokalee in southwestern Florida. Discrete water-soaked to greasy-appearing spots were observed in the leaf blades with no evidence of marginal V-shaped lesions characteristic of black rot caused by _Xanthomonas campestris_ pv. _campestris_. Profuse bacterial streaming was observed when cut leaf sections were examined microscopically. A bacterium that formed yellow colonies on nutrient agar was consistently isolated from these lesions. 10 bacteria were isolated, purified, and characterized. All strains were aerobic, Gram-negative rods. Strains were positive for esculin hydrolysis, proteolysis in litmus milk, and gelatin liquefaction. Strains were negative for urease production, nitrate reduction, oxidase, and utilization of asparagine as a sole source of carbon and nitrogen. Fatty acid methyl ester analysis indicated a match with Florida library strains of _X. campestris_ pv. _raphani_ (similarity indices 0.605-0.738). Suspensions (20 million CFU/ml in phosphate-buffered saline) of 2 Oklahoma strains identified as _X. campestris_ pv. _armoraciae_ provided by J. P. Damicone (3) and 4 representative Florida strains were applied to plants using a hand-held sprayer. Pathogenicity of the strains was tested on 3 replicate greenhouse-grown plants of the following: green cabbage cv. Market Early; red cabbage cv. Salad Delight; radish cv. Red Silk; tomato cv. Sunny; sweet bell pepper cv. Jupiter; and fresh horseradish roots purchased from a retail grocery chain. A strain of _X. campestris_ pv. _campestris_ originally isolated from Homestead, FL was also included in pathogenicity tests. All Florida and Oklahoma strains produced leaf spots, but no V-shaped lesions, on leaves of green cabbage, red cabbage, radish, tomato, and horseradish. Typical black rot symptoms were observed only in radish and green and red cabbage inoculated with the _X. campestris_ pv. _campestris_ strain. On the basis of these results, we identify the Florida strains as _X. campestris_ pv. _armoraciae_ (1,2,3), recognizing the precedent of _X. campestris_ pv. _armoraciae_ over _X. campestris_ pv. _raphani_ based on extensive genetic and serological data (1). Our strains appear to be more similar to those causing outbreaks on crucifers in Oklahoma (3) than those in Ohio (2), because Florida strains were pathogenic on tomato. References: (1) A. M. Alvarez et al. Phytopathology 84:1449, 1994. (2) F. Sahin and S. A. Miller. Plant Dis. 81:1334, 1997. (3) Y. Zhao et al. Plant Dis. 84:1008, 2000. -- ProMED-mail [_Xanthomonas campestris_ pv. _armoraciae_ [Xpa] is also present in Australia, Japan, Brazil, China, Turkey, and India. The disease is favored by cool temperatures in fall and winter, although it infects susceptible hosts over a wide temperature range. Infected plant debris is a source of inoculum and Xpa is known to be soil- and seed-borne. Disease management involves use of bacteria-free seed, planting in well drained soils, and rotation of non-cruciferous crops on a 3-year cycle. Apparently there are no tolerant or resistant cultivars. Another reference: - Mod.DH] .......................................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jul 14 11:01:01 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Quarantine pests - New Data Message-ID: <37znjhkppv.fsf@lios.aq2.gweep.ca> QUARANTINE PESTS - NEW DATA ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 11 Jul 2003 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 4 [edited] 2003/049 New data on quarantine pests and pests of the EPPO Alert List The EPPO Secretariat has extracted the following new data concerning quarantine pests and pests included on the EPPO Alert List. The situation of the pest concerned is indicated in bold, using the terms of ISPM no. 8. New geographical records: Peach latent mosaic pelamoviroid (EU Annexes) is reported for the first time from Uruguay. PLMVd was detected in 2001 during a survey in 3 locations in the Canelones Department, the main peach-growing producing area (ProMED posting, 2003). Present, found in Canelones Department. Peach latent mosaic pelamoviroid (EU Annexes) is reported as present in Brazil, Nepal, Pakistan (Hadidi et al., 1997). Present; no details. Tomato ringspot nepovirus (EPPO A2 quarantine pest) was detected on soybean in Iran (Golnaraghi et al., 2002). Detailed records: During surveys carried out in Yucatan, Mexico, phytoplasmas related to but distinct from Coconut lethal yellowing phytoplasma (EPPO A1 quarantine pest) were detected. Samples had been collected from coconut trees showing leaf yellowing in Oaxaca in 1997 and in Guerrero in 1998 (trees were then destroyed for precautionary reasons). Nutfall and inflorescence necrosis symptoms which usually precede foliar yellowing were atypically absent or delayed on these trees (Harrison et al., 2002). _Xanthomonas arboricola_ pv. _citri_ (EPPO A1 quarantine pest) was recently found in 3 new small areas in Florida (US), in the counties of Sarasota (first find in this county in private gardens), Manatee (commercial citrus grove where infections had already been found in other parts of it) and Lee (private gardens). Eradication measures continue in Florida (DOACS Press Release, 2003). Taxonomy: Considering morphological, molecular and serological characteristics, Potato latent virus (EPPO Alert list) is proposed as a new species in the genus Carlavirus (Brattey et al., 2002). Source: Brattey, C.; Badge, J.L.; Burns, R.; Foster, G.D.; George, E.; Goodfellow, H.A.; Mulholland, V.; McDonald, J.G.; Jeffries, C.J. (2002) Potato latent virus: a proposed new species in the genus Carlavirus. Plant Pathology, 51(4), 495-505. Golnaraghi, A.R.; Shahraeen, N.; Pourrahim, R.; Farzadfar, S.; Ghasemi, A. (2002) First report of the natural occurrence of eight viruses affecting soybeans in Iran. Plant Pathology, 51(6), p 794. Hadidi, A.; Giunchedi, L.; Shamloul, A.M.; Poggi-Pollini, C.; Amer, M.A. (1997) Occurrence of peach latent mosaic viroid in stone fruits and its transmission with contaminated blades. Plant Disease, 81(2), 154-158. Harrison, N.A.; Narvaez, M.; Almeyda, H.; Cordova, I.; Carpio, M.L.; Oropeza, C. (2002) First report of group 16SrIV phytoplasmas infecting coconut palms with leaf yellowing symptoms on the Pacific Coast of Mexico. Plant Pathology, 51(6), p 808. Peach latent mosaic viroid Uruguay: first report. ProMED posting of 30 Nov 2002. [search for posting number 20021129.5931] Florida Department of Agriculture and Consumer Services - DOACS Press Release of 2003-02-26. Commissioner Bronson announces new citrus canker quarantine areas in three Counties. -- ProMED-mail [Based on analysis of 16s rRNA gene sequences, the LY phytoplasma appears to be distinct from all other known coconut phytoplasmas. Potato latent virus was found in asymptomatic potatoes (_Solanum tuberosum_cv. Red La Soda) imported from USA as in vitro plants. Detected in 7 other potato cultivar accessions (Pembina Chipper, Pungo, Kanona, Red Pontiac, Purple Chief, Denali, Tejon) at the Vancouver collection of virus-free potatoes in Canada, and in 2 other cultivars in the US Varietal collection (High Plains, Platte). - Mod.DH] ..............................dh/pg/dk *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Tue Jul 15 15:48:47 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Cotton leaf curl, chili pepper - Pakistan Message-ID: <373ch7cvgh.fsf@lios.aq2.gweep.ca> COTTON LEAF CURL, CHILI PEPPER - PAKISTAN ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 14 Jul 2003 From: ProMED-mail Source: British Society Plant Pathology, NEW DISEASE REPORTS, Vol. 7 [edited] First report of cotton leaf curl disease affecting chili peppers ---------------------------------------------------------------- M Hussain, S Mansoor , I Amin, S Iram, Y Zafar, KA Malik (National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan); RW Briddon (Department of Disease and Stress Biology, The John Innes Centre, Colony Lane, Norwich, NR4 7UH, UK). Accepted for publication 8 Jul 2003. Cotton leaf curl disease (CLCuD) is an important disorder of cotton in Pakistan and Western India and is associated with begomovirus species. A symptom modulating DNA satellite (CLCuD DNA b ) is also required to induce CLCuD (1,2). Recently a CLCuD begomovirus/DNA b complex that overcomes disease resistance in cotton has been found in Pakistan (3). This prompted efforts to identify alternate host plants that may affect the epidemiology. A survey of cotton growing areas in 2002/2003 found typical CLCuD symptoms, leaf curling (LC) and vein thickening (VT), on chili pepper (_Capsicum annum_). Chili pepper production often overlaps with cotton in Pakistan and might serve as an important inoculum source. Chili peppers with LC have been shown to contain begomoviruses and a distinct DNA b has been isolated (4). But there are no reports of CLCuD affecting chili pepper. To assess CLCuD in chili pepper, plants with LC and VT were collected from the Vehari and Khanewal districts of Punjab province. To identify the begomoviruses present, total DNA was isolated from leaf samples, resolved in agarose gels and blotted onto nylon membranes. A sample from the Jhang district previously shown to contain chili leaf curl disease (ChLCD) DNA b was included. Blots were probed with a non-radioactive probe derived from cotton leaf curl Multan virus (1) and washed at low stringency. A positive signal was detected in all symptomatic chili pepper samples. Polymerase chain reaction (PCR) using primers CLCV1 [5'-CCGTGCTGCTGCCCCCATTGTCCGCGTCAC-3'] and CLCV2 [5'-CTGCCACAACCATGGATTCACGCACAGGG-3'], designed to conserved sequences of begomoviruses isolated from cotton and okra, produced products of the expected size from all symptomatic samples. DNA b was determined by PCR using a set of universal primers (4). An amplicon of the expected size (approx. 1350 nucleotides) was produced in assays of all symptomatic samples. Southern blots of extracts from symptomatic chili peppers, probed with CLCuD DNA b and washed at high stringency yielded a strong signal in samples from Vehari and Khanewal districts but not from the Jhang district. The results confirm the presence of CLCuD DNA b in chili pepper. This is the first report of CLCuD in this crop. References: 1. Briddon RW, Mansoor S, Bedford ID, Pinner MS, Saunders K, Stanley J, et al. Identification of DNA components required for induction of cotton leaf curl disease. Virology 2001; 285: 234-43. 2. Mansoor S, Briddon RW, Bull SE, Bedford ID, Bashir A, Hussain M, et al. Cotton leaf curl disease is associated with multiple monopartite begomoviruses supported by single DNA b. Arch Virol 2003 (in press). 3. Mansoor S, Amin I, Iram S, Hussain M, Zafar Y, Malik KA, et al. The breakdown of resistance in cotton to cotton leaf curl disease in Pakistan. New Disease Reports 2003; 7 . 4. Briddon RW, Bull SE, Amin I, Idris AM, Mansoor S, Bedford ID, et al. Diversity of DNA beta; a satellite molecule associated with some monopartite begomoviruses. Virology 2003 (in press). ------------------------------------------------------------------------ ProMED-mail [In addition to its presence in Pakistan, CLCuV has been reported in Egypt, Sudan, Central Africa, and Malawi, and similar symptoms have been reported in Chad, Togo, Nepal, and West Africa. Cotton is the primary natural host, but it is interesting to note that ClCuV also infects watermelon (_Citrullis lanatus_). Watermelon leaf curl disease in Pakistan is associated with tomato leaf curl India virus (ToLCV-In). Other natural hosts of CLCuV are _Solanum nigrum_ (black nightshade) and several species of _Hibiscus_. - Mod.DH] [see also: Cotton leaf curl - Pakistan (Multan) 20030612.1448] ...................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Jul 16 10:50:35 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Quarantine pests, 2002 - Lithuania Message-ID: <37k7ai8lgk.fsf@lios.aq2.gweep.ca> QUARANTINE PESTS, 2002 - LITHUANIA ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 13 Jul 2003 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO) Reporting Service 2003, No. 4 [edited] 2003/050 Situation of several quarantine pests in Lithuania in 2002 ------------------------------------------------------------------- National surveys were carried out in Lithuania for the presence of several quarantine pests. The results for 2002 are presented below. Earlier surveys (2000) had been presented in EPPO RS 2000/136. [Note: Because only diseases of food crops are monitored by ProMED-Plant, reports of insect damage to food plants are not included in this report. - Mod.DH] _Clavibacter michiganensis_ subsp. _michiganensis_ [Cmm], an EPPO A2 quarantine pest, was detected in one glasshouse of tomatoes. All infected tomatoes were destroyed, and other plants were put under strict surveillance. Present, found in one glasshouse, under eradication. _Clavibacter michiganensis_ subsp. _sepedonicus_ (EPPO A2 quarantine pest): 8 outbreaks were found, 6 of them new. 8 potato cultivars were found infected (226.5 tons) by the bacterium, including 7 cultivars of seed potatoes (139 tons) and one cultivar of ware potatoes (87.5 tons). All contaminated potatoes were used for human or animal consumption. Present, found in a few areas (8 outbreaks), under eradication. _Ditylenchus destructor_ (EU Annexes): 24 outbreaks were found in potato farms, including 17 new outbreaks. 628.4 tons of potatoes were infested by the nematode, including 476.9 tons of seed potatoes. All infested potatoes were used for human or animal consumption. Present, found in a few areas (24 outbreaks), under eradication. _Ditylenchus dipsaci_ (EPPO A2 quarantine pest): 6 outbreaks were found in 2002. 4 outbreaks were found in peat bogs (14 500 tons), and 2 outbreaks on flower bulbs grown on peat. All contaminated bulbs were destroyed, and commercialisation of infested peat was prohibited. Present, found in a few areas (6 outbreaks), under eradication. _Globodera rostochiensis_ (EPPO A2 quarantine pest): 61 outbreaks were found on a total of 344.059 ha. On infested areas it is now prohibited to grow potatoes or any other propagating material. Present, found in some areas (61 outbreaks), under eradication. Plum pox potyvirus (EPPO A2 quarantine pest): 28 orchards and nurseries were inspected (231.99 ha were inspected, out of a total area of 1195.05 ha). 3 outbreaks were found (one of them is new). 439 plum trees (_Prunus domestica_) were infected. 400 trees were pulled out and destroyed by burning. 39 trees could not be destroyed, as the grower refused to do so without compensation. Present, found in a few areas (3 outbreaks) on _Prunus domestica_, under eradication. ------------------------------------------------------------------------ ProMED-mail [This report confirms an earlier, doubtful report that Cmm had been detected in Lithuania. - Mod.DH] [see also: Quarantine pests, potato, plum - Lithuania 20010604.1103 Plant quarantine pests - Lithuania: 2000 20001014.1755] ......................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Jul 17 09:49:36 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Grapevine flavescence doree phytoplasma - Italy & Serbia Message-ID: <37r84p2lwv.fsf@lios.aq2.gweep.ca> GRAPEVINE FLAVESCENCE DOREE PHYTOPLASMA - ITALY & SERBIA ******************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases [1] Date: 15 Jul 2003 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO) Reporting Service 2003, No. 4 [edited] Grapevine flavescence doree phytoplasma in Italy ------------------------------------------------ Considering the economic importance of Grapevine flavescence doree phytoplasma [Gfdp] (EPPO A2 quarantine pest), surveys and compulsory control are being implemented in Italy. Efforts are also being made to identify the phytoplasma species that are associated with grapevine yellows. So far, Gfdp has been found only in northern Italy (Osler & Refatti, 2002). Its vector, _Scaphoideus titanus_, is present in most grapevine-growing areas of northern Italy. Severe outbreaks of the disease are present in the grapevine-growing regions of Piemonte, Lombardia, and Veneto. The disease is expanding in Liguria and Emilia-Romagna (Piacenza and Reggio Emilia), but growers are trying to delay or prevent its spread by eliminating diseased plants and controlling the vector. In areas where the first severe outbreaks of the disease had been detected and where the vector had been controlled, the number of new diseased grapevines is decreasing. Bois noir (stolbur) occurs practically in all regions of northern Italy, occasionally with flavescence doree. Symptoms of bois noir are rarely severe, and plant recovery may be observed. Bois noir occurs only in the eastern provinces of Emilia-Romagna (Valtellina), in most part of Friuli-Venezia Giulia, and in Trento province (Trentino-Alto Adige). Details on the situation in northern Italy: Emilia-Romagna: found recently in the west part of this region, particularly in Piacenza and Reggio Emilia provinces and occasionally in isolated foci in Parma and Modena provinces. Liguria: found on the west part of the coast. Lombardia: severe outbreaks occurred in most parts of this region in Oltrepo pavese, and Mantova and Brescia provinces. Isolated findings were reported in Cremona, Mantova, and Vicenza provinces. Friuli-Venezia Giulia: found near Pordenone (see EPPO RS 2003/042). Piemonte: found in 3 provinces (Alessandria, Asti, and Cuneo). Trentino-Alto Adige: first foci were found in 2001 near infested zones in Veneto. Veneto: found in a large part of this region (Padova, Treviso, Vicenza, and Verona provinces). In central and southern Italy (Barba & Albanese, 2002), bois noir was frequently detected. Gfdp was not detected, except for a finding in March 2002. Gfdp was detected in a few 35 year old grapevines, but its vector _Scaphoideus titanus_ could not be found. The risk of spread towards southern Italy cannot be ruled out. The situation of Grapevine flavescence doree phytoplasma in Italy can be described as follows: Present, found in northern Italy (Emilia-Romagna, Liguria, Lombardia, Friuli-Venezia Guilia, Piemonte, Trentino-Alto Adige, Veneto), under official control. Source: Osler R, Refatti E. [Focus on the grapevine phytoplasma diseases - Situation in northern Italy.] Informatore Fitopatologico 2002; 10: 42-8. Barba M, Albanese G. [Focus on the grapevine phytoplasma diseases - Situation in central-southern Italy.] Informatore Fitopatologico 2002; 10: 49-52. ****** [2] Date: 15 Jul 2003 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 4 [edited] 2003/059 Grapevine flavescence doree is suspected in Serbia (YU) ---------------------------------------------------------------- During a survey done in 2002 in Serbia, samples were collected from grapevines showing typical symptoms of a phytoplasma disease: leaf rolling, red discoloration, vein chlorosis and necrosis, and absence of lignification. Plant material was collected in one grapevine-growing region (Zupa Aleksandrovac) where the disease has been observed since 2000 with an increasing incidence from year to year. Molecular studies revealed the presence of phytoplasmas belonging to the elm yellows subgroup 16SrV-C, therefore suggesting the presence of grapevine flavescence doree phytoplasma (EPPO A2 quarantine pest). Further studies are being carried out to verify the presence of the insect vector, _Scaphoideus titanus_, and confirm that this grapevine yellows is associated with grapevine flavescence doree phytoplasma. Source: Duduk B, Ivanovic M, Dukic N, Botti S, Bertaccini A. First report of an Elm yellows subgroup 16SrV-C phytoplasma infecting grapevine in Serbia. Plant Disease 2003; 87(5): 599. ------------------------------------------------------------------------ ProMED-mail [There may be other phytoplasmas in addition to grapevine flavescence doree in Italian and Serbian grapevines. The availability of molecular techniques will facilitate their identification and characterization. Gpdf occurs worldwide, causing significant damage to grapevines. - Mod.DH] [see also: Elm yellows phytoplasma, grapevine - Serbia 20030523.1261 Grapevine yellows - France 20030315.0641 2002 --- Quarantine plant pathogens, food crops - Spain 20020107.3186 European stone fruit yellows, phytoplasma - Austria 20020424.4024 Bois noir phytoplasma, grapevine - Switzerland 20020712.4739 1997 --- Grapevine flavescence doree phytoplasma - Spain 19970725.1561] ....................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Fri Jul 18 14:27:44 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Citrus tristeza closterovirus - Algeria Message-ID: <37oezrshq8.fsf@lios.aq2.gweep.ca> CITRUS TRISTEZA CLOSTEROVIRUS - ALGERIA ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 16 Jul 2003 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO) Reporting Service 2003, No. 4 [edited] 2003/052 Isolated finding of citrus tristeza closterovirus in Algeria --------------------------------------------------------------------- The EPPO Secretariat has recently been informed by the NPPO of Algeria that an isolated focus of citrus tristeza closterovirus [CTV] (EPPO A2 quarantine pests) was found on 2 experimental plots of citrus propagation material. The plots were located at the experimental stations of Beni Tamou and Chebli (Wilaya of Blida). Until this finding, CTV had never been found at these locations. Phytosanitary measures were immediately taken: movement of citrus material from infected areas was prohibited and further tests (DAS-ELISA, immunoprinting, indexing) were done to delimit the extent of the infection. Samples were taken from 4869 trees and 4000 nursery plants grown at Beni Tamou and Chebli. CTV was not detected in the 4000 nursery plants tested. On trees used for the production of basic material, 4 of 996 trees (0.4 per cent), 18 of 580 pre-basic trees (3.1 per cent) and 70 of 3289 trees (2.1 per cent) tested at Chebli were positive for CTV. All 92 infected trees were destroyed. Surveys are continuing to verify the absence of the virus. The situation of CTV in Algeria can be described as follows: Present, found only in 2 citrus multiplication plots at the experimental stations of Beni Tamou and Chebli (Wilaya of Blida), under eradication. Source: NPPO of Algeria, 2003-05. ------------------------------------------------------------------------ ProMED-mail [CTV is the most damaging virus disease of citrus worldwide. Citrus tristeza disease, also known as `quick decline' in the USA, is the most destructive disease of citrus in the western hemisphere and occurs worldwide in production areas. Less than 2 decades after tristeza was introduced from Africa into South America in the 1920s, the disease had basically eliminated much of the citrus industries in Argentina, Brazil, and Uruguay. In 2002, the leading producer country was Brazil (18 694 000 tonne [metric ton; 1000 kg]) followed by USA, Mexico, Spain, Egypt, Greece, Pakistan, South Africa, and Turkey. Algeria's production was 330 000 tonnes in 2002. Disease management depends upon use of tristeza-resistant or tolerant rootstocks, screening budwood stocks for presence of the virus, and the use of mild CTV strains for cross-protection. - Mod.DH] [see also: Citrus sudden death, oranges - Brazil 20030320.0696 Citrus tristeza virus, citrus - Italy (Sicily) 20030312.0609 2002 --- Citrus tristeza closterovirus, sweet orange - Greece 20020307.3702 2000 --- Citrus tristeza closterovirus - Turkey 20000402.0486 1999 --- Citrus tristeza closterovirus - Albania 19991129.2104 1998 ---- Citrus diseases: mandatory certification 19981013.2026] ...................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Sat Jul 19 08:07:38 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Rhizomania, sugar beet - Egypt Message-ID: <37ptk6r4nq.fsf@lios.aq2.gweep.ca> RHIZOMANIA, SUGAR BEET - EGYPT ****************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 15 Jul 2003 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO) Reporting Service 2003, No. 4 [edited] 2003/056 First report of beet necrotic yellow vein benyvirus (rhizomania) in Egypt ------------------------------------------------------------ The EPPO Secretariat was informed by Professor Abdel-Salam (University of Cairo) that Beet necrotic yellow vein benyvirus [BNYVV] (causing rhizomania -- EPPO A2quarantine pest) was found for the first time in Egypt. The virus was detected in some sugarbeet crops in the governorates of El-Fayoum and Giza. The situation of BNYVV in Egypt can be described as follows: present, reported in 2002 in the governorates of El-Fayoum and Giza. Source: Abdel-Salam AM, El-Shazly MA. Occurrence of rhizomania of sugarbeet in Egypt associated with beet necrotic yellow vein benyvirus infection. Arab Journal of Biotechnology 2002; 5(1): 135-50 (abstract). ------------------------------------------------------------------------ ProMED-mail [Rhizomania is caused by Beet necrotic yellow vein benyvirus (BNYVV), which is transmitted by the soil-inhabiting fungus _Polymyxa betae_. There are 3 pathotypes of the virus (A, B, and P), with P being the most pathogenic. BNYVV infects all types of beet, causing severe damage and reducing root and sugar yields. Once a production field is infested, fungal spores remain viable for up to 30 years. Strict phytosanitary measures must be used to restrict movement of farm equipment from infested fields to virus-free fields. There are apparently no resistant cultivars but some expressing partial resistance have been recently developed. In 2002, France was the leading sugarbeet producer followed by China, Germany, Italy, Poland, Russian Federation, Turkey, Ukraine, UK, and USA. - Mod.DH] [see also: Rhizomania, sugar beet - USA (Great Lakes region) 20030210.0356 2002 --- Beet viruses, sugar beet - Syria 20021218.6089 Beet necrotic yellow vein, sugar beet - UK (England) 20020827.5164 Quarantinable plant pests - Latvia 20020726.4867 EPPO Alert List: new listings (04) 20020524.4307 Beet soil-borne pomovirus, sugar beet - Iran 20020418.3980 EPPO alert list: new listings (03) 20020417.3974 Rhizomania, sugar beet - USA (Oregon, Washington) 20020124.3369 2001 --- Beet pomovirus Q, sugar beet - Belgium 20011219.3065 Rhizomania, benyvirus, sugar beet - UK 20011121.2851 Beet necrotic yellow vein benyvirus - Denmark 20010509.0893 2000 --- Beet necrotic yellow vein benyvirus - Sweden (02) 20001128.2076 Beet necrotic yellow vein benyvirus - Sweden 20000525.0824 Beet necrotic yellow vein benyvirus - Syria 20000124.0123] .....................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jul 21 11:14:45 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Regulated plant pests, detection, April 2003: EPPO Message-ID: <37smozol8b.fsf@lios.aq2.gweep.ca> REGULATED PLANT PESTS, DETECTION, APRIL 2003: EPPO ************************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 18 Jul 2003 From: ProMED-mail Source: European and Mediterranean Plant Protection Organisation (EPPO) Reporting Service 2003, No. 4 [edited] 2003/066 EPPO report on notifications of non-compliance (detection of regulated pests) ------------------------------------------------------- The EPPO Secretariat has gathered the notifications of non-compliance (as they are now called by FAO ISPM no. 13) for 2003 received since the previous report (EPPO RS 2003/048) from the following countries: Algeria, Austria, Cyprus, Denmark, France, Finland, Germany, Ireland, Malta, Netherlands, Norway, Poland, Sweden, Switzerland, and the United Kingdom. When a consignment has been re-exported and the country of origin is unknown, the re-exporting country is indicated in brackets. When the occurrence of a pest in a given country is not known to the EPPO Secretariat, this is indicated by an asterisk (*). The EPPO Secretariat has selected notifications of non-compliance made because of the detection of regulated pests. Other notifications of non-compliance due to prohibited commodities or missing or invalid certificates are not shown. It must be pointed out that the report is only partial, as many EPPO countries have not yet sent their notifications. Pest consignment, type of commodity, country of origin, country of destination, number BACTERIAL PATHOGENS: _Erwinia_ sp.[Esp], _Solanum tuberosum_ (seed potatoes), Belgium, Cyprus, 3 Esp, _Solanum tuberosum_ (seed potatoes), France, Cyprus, 1 Esp, _Solanum tuberosum_ (seed potatoes), Netherlands, Cyprus, 3 Esp, _Solanum tuberosum_ (seed potatoes), Netherlands, Cyprus, 9 Esp, _Solanum tuberosum_ (seed potatoes), Netherlands, Cyprus, 1 Esp, _Solanum tuberosum_(seed potatoes), Belgium, Cyprus, 1 Esp, _Solanum tuberosum_ (seed potatoes), United Kingdom (Northern Ireland), Cyprus, 2 Esp, _Solanum tuberosum_ (seed potatoes), United Kingdom (United Kingdom), Cyprus, 2 _Ralstonia solanacearum_, _Solanum tuberosum_ (Ware potatoes), Bangladesh, United Kingdom, 2 FUNGAL PATHOGENS: _Fusarium_ sp. [Fsp], _Solanum tuberosum_ (seed potatoes), Netherlands, Cyprus, 9 Fsp, _Solanum tuberosum_ (seed potatoes), Netherlands, Cyprus, 1 _Phytophthora infestans_ [Pi], _Solanum tuberosum_, (seed potatoes), Netherlands, Cyprus, 1 Pi, _Solanum tuberosum_ (seed potatoes), Belgium, Cyprus, 1 Fsp, _Solanum tuberosum_ (seed potatoes), Germany, Cyprus, 1 _Monilinia fructicola_ [Mf], _Prunus domestica_, (fruits), Argentina, United Kingdom, 1 Mf, _Prunus domestica_ (fruits), South Africa, United Kingdom, 1 _Phoma sp., _Solanum tuberosum_ (seed potatoes), United Kingdom (Northern Ireland), Cyprus, 2 _Phoma sp., _Solanum tuberosum_ (seed potatoes), United Kingdom (Northern Ireland, Cyprus, 2 Pi, _Solanum tuberosum_, (seed potatoes), United Kingdom (Northern Ireland), Cyprus, 2 NEMATODE PATHOGENS: _Globodera, sp., _Solanum tuberosum_ (seed potatoes), Netherlands, Germany, 1 _G. pallida_, machinery (excavators), Soil, Japan, United Kingdom, 1 _Heterodera_ sp., machinery (excavators), soil, Japan, United Kingdom, 1 VIRAL PATHOGENS: Citrus tristeza closterovirus, _Fortunella japonica_ (unspecified), Italy, Malta,1 Pepino mosaic potexvirus, [PepMV], _Lycopersicon esculentum_, (vegetables), Spain, United Kingdom, 1 PepMV, _Lycopersicon esculentum_, (vegetables), Spain (Canary Is), Guernsey, 1 PepMV, _Lycopersicon esculentum_, (vegetables), Spain (Canary Is), United Kingdom, 2 ------------------------------------------------------------------------ ProMED-mail [Bacterial and fungal detections, as usual, are the major ones. The transport of plant parasitic nematodes in soil adhering to heavy excavators being shipped from Japan to the UK is a good example of how soilborne microorganisms get around. - Mod.DH] .......................dh/pg/sh *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Jul 23 10:14:07 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Tomato yellow leaf curl, new strain, tomato - Spain Message-ID: <37wue9gr01.fsf@lios.aq2.gweep.ca> TOMATO YELLOW LEAF CURL, NEW STRAIN, TOMATO - SPAIN ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 21 Jul 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] A New Tomato yellow leaf curl virus Strain in Southern Spain. G. Morilla, C. Ant?nez, and E. R. Bejarano, Departamento de Genetica Universidad de Malaga, 29071 Malaga, Spain; and D. Janssen and I. M. Cuadrado, CIFH "La Mojonera" El Ejido, Almeria, Spain. Plant Dis. 87:1004, 2003; published on-line as D-2003-0611-01N, 2003. Accepted for publication 19 May 2003. Tomato yellow leaf curl disease (TYLCD) has affected tomato crops annually in southern Spain since 1992, when Tomato yellow leaf curl Sardinia virus (TYLCSV-ES) was first described. In 1997, the presence of a different begomovirus species (TYLCV-[ES7297]) was reported in common bean (_Phaseolus vulgaris_). In 1999, TYLCV-[ES7297] was found in pepper (_Capsicum annuum_) (2). In September 2002, we observed tomato plants of TYLCD tolerant tomato cultivars (Kampala and Tiway) showing strong TYLCD symptoms (shortened internodes, curling of leaflet margins, and leaf blade reduction). Samples from 90 of these plants were collected from greenhouses located in the Province of Murcia and analyzed by Southern blot using the intergenic region of TYLCSV-ES[2] and TYLCV-[ES7297] as specific probes. Positive signals were obtained for TYLCV-[ES7297] and TYLCSV-ES[2] in 88 and 23 of the plants, respectively. Samples from 8 TYLCV single-infected plants (4 'Kampala' and 4 'Tiway') were analyzed by polymerase chain reaction using a pair of primers (OTYA7:GCTCCCTGAATGTTCGGATGG A and OTYA8: ATCATGGATTTACGCACAGGGG) designed to amplify a 1.9-kb fragment of any isolate of TYLCV/TYLCSV. Subsequent restriction fragment length polymorphism analysis of the amplification products yielded a restriction pattern different from that obtained for TYLCV-[ES7297]. Fragments from the 8 samples were sequenced and showed 97.9 percent identity to a TYLCV strain previously reported in Israel (X15656) (1) and only 92.7 percent identify with TYLCV-[ES7297]. To our knowledge, this is the first report that this strain of TYLCV has been detected in Spain. ------------------------------------------------------------------------ ProMED-mail [TYLCV-infected tomato plants grow slowly and are stunted and dwarfed. Leaves are greatly thickened and leathery. Yield losses are extreme because fruit production is drastically reduced and the fruit that is produced is usually not marketable. The virus is present in most tropical production areas worldwide. A concerted effort is being made to locate sources of tolerance/resistance to TYLCV; _L. cheesmanii_ ssp. minor, _L. hirsutum_, _L. peruvianum_, and _L. pimpinellifolium_ are being assessed. The replication-associated protein (Rep) from TYLCV-Sardinia is being evaluated in transgenic tomatoes transformed with Rep. Hopefully these measures will result in tomato selections that are tolerant to virus infection and also able to sustain good yields. A useful reference: - Mod.DH] [see also: Tomato yellow leaf curl, tomato - Italy 20030615.1478 2002 ---- Tomato yellow leaf curl, tomato - France 20021114.5793 Tomato yellow leaf curl, new species - Madagascar 20021122.5870 Tomato yellow leaf curl virus, bean - Cuba 20020707.4682 2001 ---- Tomato yellow leaf curl virus species 20010622.1187] ..............................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Jul 24 10:02:27 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:55 2005 Subject: PRO/PL> Barley mild mosaic, barley - Spain Message-ID: <374r1bewvh.fsf@lios.aq2.gweep.ca> BARLEY MILD MOSAIC, BARLEY - SPAIN ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 22 Jul 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] Occurrence of Barley mild mosaic virus on Barley in Spain. M. A. Achon, Area de Proteccio de Conreus, Centre UdL-IRTA Rovira Roure 191, 25198 Lleida, Spain; and C. Ratti and C. Rubies-Autonell, DiSTA, Via Filippo Re 8, 40126-Bologna, Italy. Plant Dis. 87:1004, 2003; published on-line as D-2003-0604-01N, 2003. Accepted for publication 16 May 2003. Mosaic and yellowing symptoms were observed on winter barley during March of 2002 in northeastern Spain. Symptoms were similar to those caused by Barley yellow mosaic virus (BaYMV) and Barley mild mosaic virus (BaMMV), members of the genus Bymovirus (family Potyviridae). Leaves from 17 samples of barley were analyzed by enzyme-linked immunosorbent assay (ELISA) using antisera specific for BaYMV (Bio-Rad Laboratories, Hercules, CA) and BaMMV (Loewe Biochemica, Munich). 5 samples tested positive with the BaYMV antiserum, and 2 samples were positive with the BaYMV and BaMMV antisera. Ranges of ELISA values were from 3.8 to 13 times higher than the negative controls with the BaYMV antiserum and from 18 to 21 times higher with the BaMMV antiserum. Mixed infections were further analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using specific primers that amplify 433 bp of BaYMV (1) and 445 bp of BaMMV coat protein gene (primer 1:5'GCG 7CCGTT GCA ACT GA 3' and primer 2: 5'GAA TTGCTT GTG CCA ACA 3'. A PCR product of the expected size was observed with BaMMV primers but not with BaYMV primers. The sequence of BaMMV PCR product was determined and compared with that of the equivalent regions of other BaMMV isolates (Genbank Accession Nos. AJ242725, AJ224872, D83410, D83408, L49381, Y10973, and Y10974). The greatest nucleotide identity (96-98 percent) was found with isolates from Germany and Italy, followed by those from France and the United Kingdom (89 percent), and the lowest identity being with isolates from Asia (85-88 percent). The BaYMV presence needs to be confirmed. To our knowledge, this is the first report of a bymovirus infecting barley in Spain, and illustrates the continuing spread within Europe of viruses vectored by _Polymyxa graminis_ Led. Reference: (1) D. Hariri et al. Eur. J. Plant Pathol. 106:365, 2000. ------------------------------------------------------------------------ ProMED-mail [This is the first report of BaYMV and BaMMV in ProMED-mail. BaYMV was first reported in barley (_Hordeum vulgare_) in Japan in 1940. It is transmitted by the soil-inhabiting fungus _Polymyxa graminis_ and is also mechanically transmissible. It spreads in Belgium, France, Germany, Italy, Japan, the Netherlands, and the UK. BaMMV, reported from Germany in 1984, is also transmitted by _P. graminis_ and shares transmission properties similar to those of BaYMV. It is present in eastern Asia and Eurasia as well as Belgium, China, France, Germany, Greece, Japan, and the UK. BaMMV resistance genes (rmm) are different from those for BaYMV (rym), as would be expected. - Mod.DH] ..............................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Fri Jul 25 09:45:41 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:56 2005 Subject: PRO/PL> Marssonina leaf blotch, apple - Italy Message-ID: <37llum7gpm.fsf@lios.aq2.gweep.ca> MARSSONINA LEAF BLOTCH, APPLE - ITALY ********************************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 23 Jul 2003 From: ProMED-mail Source: Amer Phytopathol Soc, DISEASE NOTES [edited] First Report of Leaf Blotch Caused by _Marssonina coronaria_ on Apple in Italy. G. Tamietti and A. Matta, DIVAPRA-Patologia vegetale, Universita di Torino, V. L. da Vinci 44, 10095 Grugliasco, Italy. Plant Dis. 87:1005, 2003; published on-line as D-2003-0605-01N, 2003. Accepted for publication 28 May 2003. During the early summers of 2001 and 2002, in Forno Canavese in northwest Italy, a leaf disease was observed on the old apple cv. Furnas in a domestic orchard. Lesions on the upper side of the leaf were brownish, smaller with more definite margins. Beginning in July 2003, scattered acervuli (95 to 170 [millimicrons]) were observed erupting through the epidermis on the upper side of leaves. Conidia were ampule-shaped, 1-septate, constricted at the septum, hyaline, guttulate, and 6.1 to 8.4 x 14.6 to 22.0 [millimicrons]. Severely diseased leaves abscised prematurely. The fungus was identified as _Marssonina coronaria_ (Ellis & J.J. Davis) J.J. Davis, teleomorph _Diplocarpon mali_ (1) although the conidia were slightly shorter than those originally described for this fungus. Monoconidial isolates were obtained by spreading mini-suspensions of conidia taken from acervuli on malt agar (MA) and transferring single-germinated conidia to MA, potato dextrose agar, V8 agar, or apple leaf agar (ALA). The fungus grew slowly, producing small colonies on V8 and ALA only. On ALA medium, after 3 months incubation at 20 to 22 deg C, the colonies were 5 to 7 mm in diameter with light brown, irregular margins and dark brown centers bearing acervuli. Conidia from pure cultures were collected, suspended in sterile, distilled water (250 000/ ml), and sprayed on the leaves of three 'Golden Delicious' apple shoots maintained in a mist chamber at 20 to 25 deg C for 2 weeks. In 2 independent experiments, the fungus reproduced symptoms like those observed on 'Furnas' and was reisolated from acervuli. No symptoms were observed on water-treated controls. To our knowledge, apple leaf blotch has not previously been reported in Italy. Although now it is a minor disease, it could become more important in sustainable crops because of its relatively low sensitivity to copper fungicides (2), the only products that can be used under that program. References: (1) Y. Harada et al. Ann. Phytopathol. Soc. Jpn. 40:412, 1974. (2) J. Ruide et al. China Fruits 2:51, 1997. ------------------------------------------------------------------------ ProMED-mail [Marssonina blotch on apple has also been reported in Canada, Japan, India, Korea, Rumania, and USA. In 2002, apple production in Himachal Pradesh state was severely affected by the disease. All commercial cultivars were susceptible, and leaf-shredding was extensive. Only small, maturing fruits were seen on affected trees. The disease was also found in Kashmir, Uttar Pradesh and Bhutan. Diseased fruits are of poor quality and not marketable. The disease can be managed by application of phytosanitary measures, appropriate pruning, and careful use of fungicides. - Mod.DH] .......................................dh/pg/mpp *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Mon Jul 28 09:47:27 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:56 2005 Subject: PRO/PL> Plant pests, new data, EPPO (03) Message-ID: <37oezezm9c.fsf@lios.aq2.gweep.ca> PLANT PESTS, NEW DATA, EPPO (03) ******************* A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 25 Jul 2003 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 5 [edited] 2003/067 New data on quarantine pests and pests of the EPPO Alert List ------------------------------------------------ By browsing through the literature, the EPPO Secretariat has extracted the following new data concerning quarantine pests and pests included on the EPPO Alert List. The situation of the pest concerned is indicated, using the terms of ISPM no. 8. New geographical records ------------------- Citrus huanglongbin or citrus greening caused by _Liberibacter asiaticus_ [La] (EPPO A1 quarantine pest) was detected in Papua New Guinea at one location (Sandaun Province, formerly West Sepik) near the border with Indonesia (ProMED-mail, 2003). The Australian Quarantine Inspection Service (AQIS) has confirmed the presence of the pathogen in Papua New Guinea. AQIS had also detected La in the Indonesian part of the island (Irian Jaya) in 1999 and in East Timor in 2000, which is also a new record for the EPPO Secretariat (AQIS web site). Situation of La in Papua New Guinea: Present, found in Sandaun Province. Situation of La in East Timor: Present, no details. Detailed records -------------- _Globodera rostochiensis_ [Gr] (EPPO A2 quarantine pest) ----------------------- This has been found in one potato field in Steuben County, New York, US. This is the first time since 1986 that the nematode has been found outside the quarantine area. So far, Gr remains confined to portions of 9 counties within the State of New York (NAPPO pest Alert, 2003) Pepino mosaic potexvirus (EPPO Alert List) ------------------------ A US isolate has been characterized and its genome sequenced. So far, the virus has been detected in tomato samples from Arizona, California, Colorado, Florida, Oklahoma, and Texas (see also EPPO RS 2001/158). This confirms the presence of Pepino mosaic potexvirus in USA (Maroon-Lango et al., 2003). _Ralstonia solanacearum_ [Rs] (EPPO A2 quarantine pest) ------------------------------- More than 100 suspect cultures were isolated from diseased potato plants from different regions of Russia in 2001-2002. Studies revealed that 37 strains were considered as Rs race 1 and 59 strains as race 3 (of which 51 were determined as race 3 biovar 2). This confirms the presence of Rs race 3 biovar 2 in Russia. Brown rot caused by Rs can cause severe losses in potato and tomato in some regions of Russia, but no details are given on its distribution within the country (Matveeva et al, 2003). New host plants ------------- _Pantoea stewartii_ (EPPO A2 quarantine pest) ------------------------ This was detected in the weed _Setaria lutescens_, which could act as an alternative host of the bacterium (Esker et al., 2003). Epidemiology --------- citrus psorosis (EU Annexes) --------------- In the Lower Rio Grande Valley of Texas (US), 4 periods of cold from 1951 to 1989 drastically reduced the area of commercial citrus, as well as the number of trees affected by citrus psorosis (EU Annexes). The use of a new psorosis-free cultivar of grapefruit (cv. Rio Red) also contributed to the reduction of disease incidence. However, during the past 6 years, more symptoms of psorosis were observed in the field, and the pattern of infection seemed to follow flood-irrigated rows, suggesting natural spread of psorosis. Examination of sections of roots and of soil collected from affected trees revealed the presence of an _Olpidium_- like fungus with resting spores. Further studies will be done on the possible role of this type of fungus in the natural transmission of citrus psorosis (Miao et al., 2003). Source: Esker, P.D.; Aalsburg, J.; Nutter Jr, F.W. (2003) Survey of alternative hosts for _Pantoea stewartii_, causal organism of Stewart's disease in Iowa. Abstract of a paper presented at the APS Annual Meeting (Charlotte, US, 2003 -08-09/13). Phytopathology 93(6), supplement, S24. Maroo-Lango, Guaragna, M.A.; Jordan, R.L.; Bandla, M.; Marquardt, S. (2003) Detection and characterization of a US isolate of Pepino mosaic potexvirus. Abstract of a paper presented at the APS Annual Meeting (Charlotte, US, 2003-08-09/13). Phytopathology 93(6), supplement, S57. Matveeva, E.V.; Pekhtereva, E.Sh.; Nikolaeva, E.V.; Schaad, N.W. (2003) Pathogenicity, virulence, and phenotypic diversity of _Ralstonia solanacearum_ strains in potato in Russian Federation. Abstract of a paper presented at the APS Annual Meeting (Charlotte, US, 2003-08-09/13). Phytopathology 93(6), supplement, S58. Miao, H.; Seyran, M.; deGraca, J.V.; Skaria, M. (2003) Circumstantial evidence of natural spread of Citrus psorosis virus in Texas. Abstract of a paper presented at the APS Annual Meeting (Charlotte, US, 2003-08-09/13). Phytopathology 93(6), supplement, S61-62. INTERNET "Australian Quarantine and Inspection Service Web site. AQIS keeps weather eye on citrus industry's Yellow Dragon in PNG" NAPPO Pest Alert Official notifications - USA. Golden nematode _Globodera rostochiensis_, detection in Fremont, New York 2003-06-12. ProMED posting of 2003-05-27. Citrus Huanglongbin Papua New Guinea (Sandaun), Archive Number 20030528.1307. ------------------------------------------------------------------------ ProMED-mail [Citrus psorosis virus (CPsV) causes a widespread and damaging disease of citrus in many parts of the world. It is the type species of the genus Ophiovirus; other members are Ranunculus white mottle virus (RWMV) and Tulip mild mottle mosaic virus (TMMMV). Mirafiori lettuce virus (MiLV) is a tentative member. All are negative stranded - ssRNA viruses, similar in morphology to those in the genus Tenuivirus. - Mod.DH] [see also: Quarantine pests - New Data 20030713.1728 Plant pests, new data, EPPO 20030312.0608 2000 ---- Plant pests, new data, EPPO (04) 20001125.2052 Plant pests, new data, EPPO (03) 20001009.1732 Plant pests, new data, EPPO (02) 20000209.0184 Plant pests, new data, EPPO 20000122.0112 1999 ---- Plant pests, new data, EPPO 19991127.2095 Plant quarantine pests, new data 19990128.0131 ..................................dh/pg/jw *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Wed Jul 30 08:45:36 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:56 2005 Subject: PRO/PL> Fireblight, apple, pear - Slovenia Message-ID: <37smoooyy8.fsf@lios.aq2.gweep.ca> FIREBLIGHT, APPLE, PEAR - SLOVENIA ************************ A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 28 Jul 2003 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 5 [edited] 2003/068 New finding of _Erwinia amylovora_ in Slovenia --------------------------------------------- The Slovenian NPPO recently informed the EPPO Secretariat of a new finding that _Erwinia amylovora_ [Ea], the bacterium that causes fireblight (EPPO A2 quarantine pest), had been found in July 2001 on an old pear tree and 2 nearby trees. As all infected trees had been destroyed and no other finds were made, the disease was provisionally considered as eradicated (see EPPO RS 2001/120). However, Ea was found again during a systematic survey in 2002 of private gardens situated in the close vicinity of the infected area in the northern part of Slovenia and subsequently confirmed on 20 May 2003. The first new focus was found in the town Skofja Loka , located 13 km south of the first finding in Naklo. The focus and 1-km buffer zone are considered an infected area, where immediate destruction of all host plants showing symptoms was ordered by burning infected plants at the orchard site or in its nearest vicinity. An intensive survey programme was imposed in a 5-km buffer zone, and all host plants in a 10-km buffer zone are being monitored. Despite strict measures taken in every focus, 73 new foci were reported from 26 May to 18 June 2003. Blight forecasters issued 3-4 warnings in early May. The outbreaks are considered as the result of blossom infection. Stormy weather and the appearance of exudate enabled further spread. A map of the controlled area can be viewed on: Surveys of other intensive plantations in Slovenia (in total: 2659 ha of apple and 240 ha of pear) are still in process. The situation of Ea in Slovenia can be described as follows: Present, found in the northern part of Slovenia, under official control. ------------------------------------------------------------------------ ProMED-mail [Fireblight is a serious disease of apples, pears, and related trees and shrubs in the family Rosaceae, sub-family Maloideae (pome fruits). It is native to North America, was introduced to Europe in the 1950s, and has spread throughout many countries in Europe and the Middle East. Disease management involves use of sterilized cutting tools (alcohol or bleach), pruning of all branches below the site of obvious infection (at least 30 to 60 cm, depending on branch diameter), burning of cut branches and, in the case of severe disease, removal and burning of infected trees and use of recommended bactericides. - Mod.DH] [see also: Fire blight, various hosts - Norway 20030430.1067 2002 ---- Fireblight, plant host survey - Slovakia 20020727.4872 Quarantinable plant pests - Latvia 20020726.4867 2000 ---- Fire blight, quarantine policy - Australia 20001019.1805 Fire blight on-line resources (02) 20000620.1004 Fire blight on-line resources 20000323.0412 Fire blight, apples - Spain 20000321.0401 1999 ---- Fire blight, pears - USA (Texas) 19990409.0588 1997 ---- Fireblight - Australia: RFI 19970723.1543 Fireblight - Australia (02) 19970724.1557] .................................dh/pg/jw *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################ From brian at gweep.ca Thu Jul 31 15:24:53 2003 From: brian at gweep.ca (Brian Edmonds) Date: Sat Jan 15 17:13:56 2005 Subject: PRO/PL> Potato wart disease - Estonia: eradicated Message-ID: <377k5yie3e.fsf@lios.aq2.gweep.ca> POTATO WART DISEASE - ESTONIA: ERADICATED **************************************** A ProMED-mail post ProMED-mail is a program of the International Society for Infectious Diseases Date: 29 Jul 2003 From: ProMED-mail Source: EPPO Reporting Service 2003, No. 5 [edited] 2003/070 Surveys carried out in Estonia: absence of _Synchytrium endobioticum_ ------------------------------------------------------------------- The NPPO of Estonia recently informed the EPPO Secretariat of the results of surveys carried out in 2002 for _Synchytrium endobioticum_ [Se] (EPPO A2 quarantine pest). In the past, Se had been found in 3 districts: Rapla district (one site) in 1949, Voru district (10 sites) in the 1970s and Valga district (2 sites) in 1985. In all cases, phytosanitary measures were immediately taken and the disease was eradicated. In 2002, 26 samples were taken from all previously infected sites and their vicinity. In addition, random samples were taken in other districts. All samples were analysed in the laboratory and Se was not found. The situation of Se in Estonia can be described as follows: Absent, found in the past but now declared eradicated, confirmed by survey. ------------------------------------------------------------------------ ProMED-mail [Se causes a very serious disease in potato and other _Solanum_ species. Its spores can remain viable for many years. It would appear that conditions for survival of the spores were favorable but eventually they lost their viability. Diseased tubers are obvious. Disease management involves preventing spread of infected tubers, washing machinery and tools to remove adhering soil, and use of resistant cultivars. Infected tubers are not marketable, hence crop loss can be directly related to disease incidence. Note: This report also included a piece about a disease in forest trees that was deleted, since ProMED-mail monitors major food crops only. - Mod.DH] [see also: 2002 ---- Potato wart disease - Canada (PEI) (02) 20020907.5253 Potato wart disease - Canada (Prince Edward Island) 20020906.5243 2001 ---- Potato wart, potato - Canada (Prince Edward Island) 20011229.3136 2000 ---- Potato wart disease - Canada (P.E.I.): EPPO report 20001225.2276 Potato wart disease - Netherlands 20001118.2016 Potato wart disease - Canada (Prince Edward Island) 20001028.1877 Potato wart disease 20000211.0191 1999 ---- Plant pests - Russia 19991202.2114] .......................................dh/pg/jw *##########################################################* ProMED-mail makes every effort to verify the reports that are posted, but the accuracy and completeness of the information, and of any statements or opinions based thereon, are not guaranteed. The reader assumes all risks in using information posted or archived by ProMED-mail. ISID and its associated service providers shall not be held responsible for errors or omissions or held liable for any damages incurred as a result of use or reliance upon posted or archived material. ************************************************************ Visit ProMED-mail's web site at . Send all items for posting to: promed@promedmail.org (NOT to an individual moderator). If you do not give your full name and affiliation, it may not be posted. Send commands to subscribe/unsubscribe, get archives, help, etc. to: majordomo@promedmail.org. For assistance from a human being send mail to: owner-majordomo@promedmail.org. ############################################################ ############################################################